ID: 1164736999

View in Genome Browser
Species Human (GRCh38)
Location 19:30548956-30548978
Sequence AAGCAGTTTGGTGTTTACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 332}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164736992_1164736999 24 Left 1164736992 19:30548909-30548931 CCGGCCACGTGGACCCTGCATTT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736996_1164736999 -7 Left 1164736996 19:30548940-30548962 CCCATCAGACTTCTACAAGCAGT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736994_1164736999 11 Left 1164736994 19:30548922-30548944 CCCTGCATTTTGTAACTTCCCAT 0: 1
1: 0
2: 3
3: 20
4: 298
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736995_1164736999 10 Left 1164736995 19:30548923-30548945 CCTGCATTTTGTAACTTCCCATC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736997_1164736999 -8 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736993_1164736999 20 Left 1164736993 19:30548913-30548935 CCACGTGGACCCTGCATTTTGTA 0: 1
1: 0
2: 0
3: 13
4: 70
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164736999 Original CRISPR AAGCAGTTTGGTGTTTACCC AGG Exonic
901133216 1:6975827-6975849 AAGCAGATTGGTGGTTGCCAAGG - Intronic
902169107 1:14596624-14596646 AAGCAGATTGGTGTTTGTCAGGG - Intergenic
903233531 1:21936026-21936048 AACCAGGCTGGTGTTTACCCAGG - Intronic
904548469 1:31295631-31295653 AAGAATTTTGGTTTTTACTCTGG + Intronic
905934292 1:41811381-41811403 AAACAGTCTGGTGTTAACCTTGG + Intronic
906328352 1:44863601-44863623 AAGCTGTTTGGTGGATACACAGG - Intronic
906710849 1:47928913-47928935 AAGCAGTTAGGGTTTTACCTGGG - Intronic
907775178 1:57507115-57507137 AAGGACTTTGGCGTTTATCCTGG - Intronic
908500884 1:64743448-64743470 ACACAGATTGGTGTTTACCAAGG - Intergenic
908664802 1:66478059-66478081 AAGGAGTTTAGGTTTTACCCTGG - Intergenic
908974161 1:69877687-69877709 AAGCAGTTTAGTAGTTACCTGGG - Intronic
909196507 1:72633042-72633064 AAGCAGATTGGTGCTTGCCTGGG - Intergenic
910192833 1:84611893-84611915 GTGAAGTTTGGTGATTACCCAGG - Intergenic
910210403 1:84786789-84786811 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
910347158 1:86253017-86253039 AAGCAGATTAGTGGTTACCTAGG + Intergenic
910695678 1:90012415-90012437 AAGCAGATTAGTGGTTACCAGGG + Intronic
910960703 1:92759632-92759654 AAGTAGATTAGAGTTTACCCAGG - Intronic
913140295 1:115934566-115934588 AAGCAGTTTGTTGTTATCTCTGG - Intergenic
913239485 1:116817674-116817696 AAGAAATTTGCTGTTTACCTAGG + Intergenic
914216677 1:145637036-145637058 AGGCTCTTTGGTGTTTACCGTGG - Intronic
915845671 1:159261948-159261970 AAGCAGGTTAGTGCTTGCCCAGG + Intergenic
917143496 1:171862547-171862569 AAGCAGATTGGTGTTTGCCAGGG + Intronic
920905058 1:210156464-210156486 GAACAGTTTGCTGTTTACCCTGG + Intronic
921292474 1:213671341-213671363 GAGCAGAATGGTGTTTACCAGGG + Intergenic
923016490 1:230130524-230130546 AGGCAGTTTGGGGTTTACTAGGG + Intronic
924805343 1:247357287-247357309 GTGAAGTTTGGTGTTTACCCAGG + Intergenic
1066079784 10:31919191-31919213 AAGCAGAATGGTGGTTACCAAGG + Intronic
1066371996 10:34825168-34825190 AACAAGCTTGGTGTTCACCCTGG - Intergenic
1067384363 10:45805103-45805125 AAGCAGATTGGTGGTTGCCTAGG - Intergenic
1067724003 10:48752558-48752580 AAGCAGATTGGTGGTAGCCCAGG - Intronic
1067892056 10:50145663-50145685 AAGCAGATTGGTGGTTGCCTAGG - Intergenic
1068224041 10:54083595-54083617 ACGCAGATTGGTGTTTGCCAGGG + Intronic
1068438347 10:57019312-57019334 AGGCAGATTGGAGTTTTCCCAGG + Intergenic
1068450429 10:57179427-57179449 AAGCACATTGGTGGTTACCTGGG - Intergenic
1068648561 10:59496424-59496446 GTGAAGTTTGGTGATTACCCAGG + Intergenic
1069603648 10:69725983-69726005 AAGCAGAATGGTGGTTACCAGGG - Intergenic
1069692642 10:70363964-70363986 AAGCAGGTGGGAGTTTACCAGGG - Intronic
1069693480 10:70370089-70370111 AAGCAGTTTAGTCTTTGCCTGGG + Intronic
1070108484 10:73459768-73459790 CAGCAGATTGGTGGTTACCTAGG + Intronic
1071449541 10:85780963-85780985 AAGCACTCTGGTGTTCACCATGG - Intronic
1071850503 10:89564272-89564294 AAGCAGATTGGTGCTTGCCAGGG + Intergenic
1072424143 10:95315087-95315109 AAGCAGTTTGGTACTTTTCCAGG - Exonic
1072476354 10:95764184-95764206 AAGTAGATTGGTGTTTTCCTAGG - Intronic
1072583518 10:96761060-96761082 AAGGAGTATGGTATTTTCCCAGG + Intergenic
1073008702 10:100343563-100343585 AAGTAGATTGGTGGTTGCCCAGG - Intergenic
1073221880 10:101881388-101881410 AAGCAGGCTGGTGGTTACCAGGG + Intronic
1076002220 10:126921523-126921545 AAGCAGATTAGTGGTTGCCCGGG + Intronic
1078204634 11:9217567-9217589 AAGTAGATTAGTGTTTACCTGGG + Intronic
1078361414 11:10671101-10671123 AAGGAGTTTTGTGGTTAGCCTGG - Intronic
1079428802 11:20368748-20368770 AAGCAGTTTAGACTTTTCCCTGG - Intronic
1079633614 11:22708829-22708851 AAACAGTGTGGATTTTACCCAGG + Intronic
1079934758 11:26603130-26603152 AATCAGTTTTATGTTTGCCCAGG - Intronic
1080565671 11:33507041-33507063 CAGCAATTTGGTATTTTCCCTGG - Intergenic
1081518337 11:43856336-43856358 AAGAAGATTGGTCTTTACCTAGG + Exonic
1081720184 11:45283164-45283186 AAGAAATTTGGAGTTTTCCCAGG - Intronic
1082126621 11:48439353-48439375 AAGCAGATTAGTGGTTACCAGGG - Intergenic
1084348899 11:68579327-68579349 AAGCAAATTGGTGTTTACTTTGG - Intronic
1085517573 11:77120547-77120569 AAGCGGATTCGTGTTTGCCCAGG - Intronic
1087051500 11:93890372-93890394 GTGAAGTTTGGTGATTACCCTGG - Intergenic
1087400737 11:97664014-97664036 AAGAAGTTTGGTGGTTATTCAGG + Intergenic
1087742107 11:101899648-101899670 AAGCAATTTGGCTTATACCCAGG - Intronic
1090765579 11:129873515-129873537 GAGCAGTCTGGTGGTTTCCCCGG - Intronic
1090819191 11:130325817-130325839 AAGCAGATTAGTGGTTACCAAGG - Intergenic
1091016253 11:132053535-132053557 AAGCTGTTAGGTGTTTTCCTTGG + Intronic
1092673148 12:10885988-10886010 AGGCAGATTGGTATTTTCCCTGG + Intronic
1092716770 12:11397227-11397249 AGGCAGATTGGTATTTTCCCTGG + Intronic
1092731500 12:11539177-11539199 AAGCAGATTGGTGGTTTCCAGGG - Intergenic
1094500811 12:31019467-31019489 AAGCAGATTGGTGTTTTCCAGGG + Intergenic
1094657674 12:32436557-32436579 AACCAGTTTGGTGTTACGCCTGG + Intronic
1094706242 12:32916683-32916705 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1095806958 12:46330262-46330284 AAGCAGATTGGTGGTTGCCTAGG + Intergenic
1096296945 12:50392116-50392138 AAGCAGATTGGTGGTTAGCTGGG + Intronic
1096916950 12:55043673-55043695 AAGCAGGTTAGTGGTTACCAGGG + Intergenic
1097670396 12:62530160-62530182 AAGCAGATTGGTGATTCCCAGGG - Intronic
1097918262 12:65042663-65042685 AAGTAGATTGGTGGTTGCCCGGG - Intergenic
1101067267 12:101035346-101035368 AAGCAGATCAGTGTTTGCCCTGG + Intronic
1101705767 12:107219499-107219521 AAGTAGTTTAGTGGTTACCTAGG - Intergenic
1101730810 12:107425630-107425652 AAGCGGTCTGGTTTTCACCCGGG - Intronic
1102150197 12:110684088-110684110 AAGCAGATTGGTGGTTGCCAGGG + Intronic
1102549501 12:113681396-113681418 AAGCAGATTGGTGGTTTCCAGGG + Intergenic
1102819103 12:115892931-115892953 AAGCAGATTGGTGGTTGCCAGGG - Intergenic
1102888636 12:116540793-116540815 AAGCAGTTTGATGGTTACCAGGG - Intergenic
1104006731 12:124898284-124898306 AAACAGATTGGTGTTCACCAGGG + Intergenic
1104459239 12:128941003-128941025 AAGTAGATTGGTGGTTACCCAGG - Intronic
1105489987 13:20879084-20879106 AAGCACTCATGTGTTTACCCTGG + Intronic
1106352056 13:28940427-28940449 CAGCAAATTGGTGTTTACCAGGG + Intronic
1106838120 13:33658082-33658104 AAGTAGTATGGTGGTTACCAGGG - Intergenic
1107407896 13:40131952-40131974 AAGTAGTTTAGTGATTGCCCAGG - Intergenic
1107701677 13:43054966-43054988 GTGAAGTTTGGTGATTACCCAGG - Intronic
1108115138 13:47119174-47119196 AAGGACTTTGGCTTTTACCCTGG + Intergenic
1108299549 13:49060806-49060828 AAGCAGATTGGTGATTACCAGGG + Intronic
1108452437 13:50580652-50580674 AAGCAGAGTGGTGTTTGCCAGGG - Intronic
1108480351 13:50863943-50863965 AAGCAGAATGGTGATTACCTGGG + Intergenic
1110405316 13:75144390-75144412 AAGCATTTTGAAGTTTACTCAGG - Intergenic
1110574358 13:77038796-77038818 AATCAGGATGGTGGTTACCCAGG - Intergenic
1110712305 13:78663809-78663831 AAGAACCTTGGTATTTACCCCGG - Intergenic
1110712431 13:78664662-78664684 GTGAAGTTTGGTGATTACCCAGG + Intergenic
1111513773 13:89299734-89299756 AAGCAAATTGGTGTTTGCCTGGG + Intergenic
1112811374 13:103223003-103223025 AAAGGGTTTGGTGTTTATCCTGG + Intergenic
1113344892 13:109467676-109467698 ATGCTGTTTGGTCTTTGCCCTGG - Intergenic
1114076293 14:19162972-19162994 CTGAAGTTTGATGTTTACCCGGG + Intergenic
1114085871 14:19236597-19236619 CTGAAGTTTGATGTTTACCCGGG - Intergenic
1115177750 14:30584038-30584060 AAGCAGATTAGTGGTTACCAGGG - Intronic
1117472191 14:56057151-56057173 ATGCATTTTTCTGTTTACCCAGG + Intergenic
1119045672 14:71316459-71316481 AAGCATTTTAGTTTTTACCACGG + Intergenic
1119168171 14:72513104-72513126 AAGCACTTTGTAATTTACCCAGG - Intronic
1119210593 14:72828744-72828766 AAGGAGTTTGGACTTTATCCTGG + Intronic
1119211401 14:72835016-72835038 AAGCAGATTAGTGGTTACCAGGG + Intronic
1120358770 14:83467946-83467968 AAGCACTTTGAGGTTTACACTGG - Intergenic
1120792066 14:88593331-88593353 AAGCAATTTGGGGTTTAAACAGG - Intronic
1122673294 14:103388695-103388717 AAGCAGATCAGTGGTTACCCAGG - Intronic
1202897427 14_GL000194v1_random:18309-18331 CTGAAGTTTGATGTTTACCCGGG - Intergenic
1123672173 15:22670010-22670032 AAGTAGATTGGTGGTTGCCCAGG - Intergenic
1124324223 15:28743308-28743330 AAGTAGATTGGTGGTTGCCCAGG - Intergenic
1124528106 15:30476345-30476367 AAGTAGATTGGTGGTTGCCCAGG - Intergenic
1124576500 15:30913593-30913615 CAGTAGGTTGGGGTTTACCCTGG - Intronic
1124770551 15:32531359-32531381 AAGTAGATTGGTGGTTGCCCAGG + Intergenic
1124996769 15:34731199-34731221 AAGCAGATTGGAGGTTACCAGGG + Intergenic
1125923933 15:43546059-43546081 AAGCAGATTGGTGGTTTCCAGGG - Intronic
1126082573 15:44979656-44979678 GTGCAGTTTGGTTTTTCCCCAGG - Intergenic
1126332194 15:47545192-47545214 AAGCAGATTGATGTTCACCCTGG - Intronic
1126476205 15:49067950-49067972 AAGCAGTTTGGTGGTTGCCAGGG - Intergenic
1126693162 15:51303502-51303524 AAGCACTTGTGTGTTTAGCCTGG - Intronic
1127360291 15:58239168-58239190 AAGTAGATTGGTGTTTACCTAGG + Intronic
1128593093 15:68920062-68920084 AAGCAGATTGTTGTTTTCCAGGG + Intronic
1129367629 15:75066266-75066288 GTGAAGTTTGGTGATTACCCAGG + Intronic
1129770024 15:78197211-78197233 AAGCAGATTCGTGTTTGCCCCGG + Intronic
1129810321 15:78505203-78505225 AAGCAGAATGGTGTGAACCCAGG - Intergenic
1130203859 15:81857740-81857762 AAGCAGAATGGTGATTACCAAGG + Intergenic
1130318249 15:82815268-82815290 AAGTAGATTGGTGGTTGCCCAGG - Intronic
1133186655 16:4104351-4104373 ATGCTGTTGGGTTTTTACCCAGG - Intronic
1133582806 16:7162861-7162883 AAGCAGTGTGGGGTATTCCCTGG + Intronic
1135581650 16:23632550-23632572 ATGCAGATTGGTGGTTGCCCAGG + Intronic
1135595072 16:23735886-23735908 AAGCGGATTGGTGGTTACTCAGG - Intergenic
1138378162 16:56581263-56581285 AAGCAGCTTTCTCTTTACCCAGG + Intergenic
1141176394 16:81722619-81722641 AAGCAGATTGGTGTTTGCCAGGG + Intergenic
1141258963 16:82433235-82433257 AAGCAGATCAGTGGTTACCCAGG - Intergenic
1141270242 16:82533008-82533030 AAGCAGATTAGTGGTTACCTGGG - Intergenic
1141417654 16:83888885-83888907 GTGAAGTTTGGTGATTACCCAGG + Intergenic
1145260864 17:21353755-21353777 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1146642238 17:34550183-34550205 AAACAGTTTGGACTTTATCCCGG + Intergenic
1146698798 17:34935215-34935237 AAGTAGAATGGTGGTTACCCAGG + Intronic
1146815953 17:35942719-35942741 GTGAAGTTTGGTGATTACCCAGG - Intronic
1148673547 17:49431606-49431628 AAGCAGATTGGTGGTTGCCTAGG + Intronic
1148904584 17:50904319-50904341 AAGCAGATTGGTGCTTGCCTGGG + Intergenic
1149804285 17:59600178-59600200 AAGCAGATTAGTGGTTACCTGGG - Intronic
1152024540 17:77800258-77800280 AAGCAGATTGGTGGTTGCCTAGG + Intergenic
1152075941 17:78159744-78159766 AAGCAGATTGGTGGTTACTGGGG - Intronic
1152416288 17:80164582-80164604 AAGCAGATTGGTGGTTGCCTTGG + Intergenic
1154002941 18:10499922-10499944 AAGCAGATTAGTGGTTGCCCAGG - Intergenic
1155769419 18:29678127-29678149 AAGCAGTTTGGTGATTTCTCAGG + Intergenic
1156584383 18:38415754-38415776 CAGCAGCTTGGGGTGTACCCCGG + Intergenic
1157467735 18:47961881-47961903 AAGTAGATTGGTGGTTACCTAGG - Intergenic
1157563739 18:48665656-48665678 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1157623464 18:49029392-49029414 GAGCAGTTGGGAGTTTACCCTGG + Intergenic
1159291306 18:66425155-66425177 GAGCAGAATGGTGTTTACCAGGG + Intergenic
1159395605 18:67851764-67851786 AAGCAGATTAGTGTTTGCCAGGG - Intergenic
1160292245 18:77605733-77605755 ATGAAGTTTGGTGATTACCAAGG + Intergenic
1162005679 19:7777279-7777301 AAGCAGAATGGTGATTACCAGGG + Intergenic
1162156675 19:8683281-8683303 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1162352130 19:10157220-10157242 AAGCAGATTGGTGGTTGCCGGGG - Intronic
1163009343 19:14415146-14415168 AAGCAGATTAGTGGTTGCCCGGG - Intronic
1163275744 19:16283197-16283219 AAACAGATTGGTGTTTGCCAGGG + Intergenic
1163280546 19:16314122-16314144 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1163401402 19:17095378-17095400 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1163544870 19:17935269-17935291 AAGCAGATTGATGGTTACCAGGG + Intronic
1163735705 19:18979151-18979173 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1163825387 19:19520780-19520802 AAGCAGATTAGTGTTTGCCAGGG - Intronic
1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG + Exonic
1166205470 19:41265978-41266000 AAGCAGTTATTTGTGTACCCAGG + Intronic
1167164962 19:47792571-47792593 AAGCAGATTGGTGGTTGCCCAGG - Intergenic
1167774815 19:51547983-51548005 GTGAAGTTTGGTGGTTACCCAGG - Intergenic
1168635475 19:57993002-57993024 AAGGACTTTGGTGATTACACTGG - Intronic
926445045 2:12931314-12931336 ATGCAGTTGTGTGTTTTCCCGGG + Intergenic
926693890 2:15757155-15757177 AAGCAGGTTGGTGGTTGCCAGGG + Intergenic
927014049 2:18937690-18937712 AAGCATATTGGGGTTTACCTGGG - Intergenic
927577249 2:24209873-24209895 AAGCAGTTTGCTGTTTCCTCTGG - Exonic
929651357 2:43682746-43682768 AAGCAGATTGGTGGTTGCCAGGG - Intronic
929856030 2:45639385-45639407 AAGCAGGTTGGTGTTCTTCCTGG - Intergenic
932196684 2:69789987-69790009 GTGAAGTTTGGTGATTACCCAGG + Intronic
933480787 2:82854636-82854658 AAGCAGACTAGTGTTTACCTAGG + Intergenic
933745803 2:85570505-85570527 AAGAAGTTTGGGCTTTATCCTGG + Intronic
935528842 2:104207207-104207229 AAGCAGTTGGTTGGTTACCGAGG + Intergenic
936057860 2:109274599-109274621 AAGCAGATTGGTGGTTGCCATGG + Intronic
936783718 2:116067159-116067181 AAGCAGTTTGGAGATTTCTCAGG + Intergenic
938102805 2:128508977-128508999 AAGCAGTGTGGTATTGACCCAGG - Intergenic
938160167 2:128978646-128978668 AAGGAGTTTGGTTTTCACTCTGG + Intergenic
938160640 2:128981960-128981982 TTGCAGTTTTGTGTTTAGCCTGG + Intergenic
938805126 2:134799903-134799925 AAGCAGTTGGGTTTTAACCAAGG + Intergenic
938886439 2:135654145-135654167 AAGCAGATTGGTGGTTGCCAGGG - Intronic
941030170 2:160501873-160501895 AAGCAGATTGCTGGTTACCAGGG - Intergenic
942625300 2:177894077-177894099 AAACAGTTTCCTGTTTATCCTGG + Intronic
942948211 2:181693007-181693029 ATGCAGTTTAGTGATTTCCCGGG + Intergenic
944011199 2:194977497-194977519 GAGAAGTCTGGTCTTTACCCTGG - Intergenic
944026495 2:195176065-195176087 AAGCAGTTTAGTGGTTAACAGGG + Intergenic
944111258 2:196132941-196132963 GTGAAGTTTGGTGATTACCCGGG + Intergenic
944603574 2:201329058-201329080 AAGCAGATTAGTATTTACCATGG - Intronic
944758084 2:202784782-202784804 AAGCAGAATGGTGGTTACCGGGG + Intronic
945232262 2:207604760-207604782 AAGCAGATTGGTGGTTGCCAGGG - Intronic
945345339 2:208706678-208706700 AAGCAGATTGGTGGTTGCCTGGG - Intronic
945673536 2:212830813-212830835 CTGCAGTTTGGGGTTTATCCTGG + Intergenic
945723950 2:213452074-213452096 GTGAAGTTTGGTGATTACCCAGG + Intronic
946019128 2:216627881-216627903 AAGCAGTTTGGAGATTTCACAGG - Intergenic
947060204 2:226155819-226155841 AAGCAGATTGCTTTTTATCCAGG + Intergenic
947580474 2:231313665-231313687 AAGCAGATTGATGGTTACCTGGG - Intronic
948065938 2:235080002-235080024 AAGCAGATTAGTGTTTGCCTAGG - Intergenic
948321973 2:237076961-237076983 AAGCAGATTGGTGGTTGCCATGG - Intergenic
1168891684 20:1299190-1299212 AAGCTGTATGGTGTTTACCGAGG - Intronic
1170510145 20:17068058-17068080 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1171406687 20:24916532-24916554 CAGCACTGTGGTGTTCACCCAGG - Intergenic
1172042534 20:32055845-32055867 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1172125310 20:32622126-32622148 AAGCGGTGTGGAGTTTGCCCCGG + Intergenic
1172125554 20:32623361-32623383 AAGCAGTGTGGAGTTTGCCCTGG + Intergenic
1172432566 20:34904815-34904837 AAGTAGTTTGGTTTATACCAAGG + Intronic
1174278800 20:49423306-49423328 AAGCAGCTTGGTGGTTGCCTGGG + Intronic
1175177990 20:57125172-57125194 AAGCAGATTCGTGGTTACCAGGG + Intergenic
1175634362 20:60568312-60568334 ACAAAGTTTGGTGTCTACCCTGG + Intergenic
1176233624 20:64044036-64044058 AAGCAGTTTAGTGTTTATCAGGG + Intronic
1176617112 21:9034298-9034320 CTGAAGTTTGATGTTTACCCGGG - Intergenic
1177573921 21:22925918-22925940 AATCAGTTTGGTGTGTTCACTGG - Intergenic
1178430813 21:32517303-32517325 AAGCAAATTGGTGTTTTCCAGGG - Intergenic
1178574220 21:33770580-33770602 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1178907526 21:36649046-36649068 AAGCAGATTGGTGGTTTCCAGGG + Intergenic
1179147485 21:38781065-38781087 AAGCAGATTGGTGGTTTCCAGGG - Intergenic
1180292100 22:10856596-10856618 CTGAAGTTTGATGTTTACCCGGG + Intergenic
1180330001 22:11468921-11468943 AGACAGTTTGGTGTTTCCTCAGG + Intergenic
1180494904 22:15886018-15886040 CTGAAGTTTGATGTTTACCCGGG + Intergenic
1180754133 22:18148578-18148600 GCGCAGTATGGTGTTTACACAGG - Intergenic
1183321945 22:37170251-37170273 AGGAAGTTTGGTGTTTGCCAAGG + Intronic
949290229 3:2456541-2456563 AAGCAGATTGGTGTTTGCTAGGG - Intronic
950322088 3:12065954-12065976 AAGCAGATTAGTGGTTACCTAGG + Intronic
952216462 3:31282970-31282992 AAGCACTTTGGCTTTTACTCTGG + Intergenic
953775582 3:45814114-45814136 AAGCAGTTCGGTGCTTGCTCAGG + Intergenic
954041555 3:47891711-47891733 AATCACTATGGTGTTCACCCAGG - Intronic
954343815 3:49979240-49979262 AAGCAGATTGGTGGTTGCCAGGG + Intronic
954902247 3:54030136-54030158 AAGCAGATTAGTGGTTGCCCGGG + Intergenic
955779768 3:62472169-62472191 AAGTATTTTGGTGATTACCTAGG + Intronic
955998744 3:64705994-64706016 ATGCAGATTGGTGTTTGCCAGGG - Intergenic
956903850 3:73744896-73744918 AAGCAGGATGATGGTTACCCAGG - Intergenic
959051730 3:101530763-101530785 ATGAAGTTTGGTGATTACCCAGG + Intergenic
960026433 3:113016183-113016205 AAGAAGTTTGGTCTTTACTCAGG + Intronic
960702737 3:120452668-120452690 ATGCAGTTTAGTTTTTACACAGG - Intergenic
961015238 3:123463250-123463272 AAGCAGATTGGTGGTTCCCTGGG + Intergenic
961815097 3:129545609-129545631 AAGCAGATTGGTGGTTGCCAGGG - Intronic
963276507 3:143336708-143336730 AAGCAGGTTGGTGGTTGCCAGGG + Intronic
965148793 3:164943275-164943297 CAGCAGAATGGTGTTAACCCAGG - Intergenic
965884793 3:173431904-173431926 AAGAAGTTTGGTGGTTTCCAGGG - Intronic
966687937 3:182716184-182716206 GTGAAGTTTGGTGATTACCCAGG + Intergenic
967025653 3:185561619-185561641 AAGCAATTTGTTGTCTTCCCTGG + Intergenic
969340875 4:6540236-6540258 AAGCAGATTAGTGGTTACCAGGG - Intronic
972112074 4:35575610-35575632 AAGCACATTGGTGGTTACCCAGG - Intergenic
972730595 4:41790903-41790925 AAAGGGTTTGGTGTTTGCCCTGG - Intergenic
972788038 4:42345844-42345866 AAGCAGCTTGGTGGTTGCCTGGG - Intergenic
976814289 4:89128678-89128700 AAGCAGTTTGGGCTTCACCAAGG - Intergenic
979319606 4:119307951-119307973 AAGTAGAGTGGTGTTTACCAGGG + Intergenic
980193705 4:129560212-129560234 AAACAGTATGGTGGTTACCAGGG - Intergenic
982340573 4:154293697-154293719 AAGCTGTGTGGAGTGTACCCTGG - Intronic
983062025 4:163171779-163171801 GTGAAGTTTGGTGATTACCCAGG - Intergenic
983063779 4:163187615-163187637 GTGAAGTTTGGTGATTACCCAGG + Intergenic
983476265 4:168215398-168215420 AAGGAGAATGGTGTTAACCCAGG + Intergenic
983918415 4:173316780-173316802 AAACAGGTAGGGGTTTACCCTGG - Intronic
984842995 4:184085520-184085542 AAGCAGTTTCGTGGTTGCCTGGG + Intergenic
985355313 4:189112755-189112777 ACACAGTTTGGGGTTTAACCAGG - Intergenic
985619465 5:946486-946508 AATCTGCTTTGTGTTTACCCGGG - Intergenic
985945465 5:3179047-3179069 AAGCATTTTGTTGGTTACCCAGG - Intergenic
987007117 5:13722169-13722191 AAGCTGTTTTGTGTTTCTCCGGG - Intronic
987572083 5:19676840-19676862 AACAAGTGTGGTGTTTAACCTGG - Intronic
987836288 5:23167614-23167636 CTGCTGTTTGCTGTTTACCCAGG - Intergenic
989967042 5:50476503-50476525 AAGCAGCTTGGTTTTTATTCTGG + Intergenic
990447843 5:55909066-55909088 AAGCAGTTTGGTAGTTGCCAGGG - Intronic
990723734 5:58729424-58729446 AAGCAGGTTGGTGTTTGCTGAGG - Intronic
991918897 5:71634050-71634072 AAGGAGTTTGGTGTTTTCCCAGG + Intronic
992218523 5:74548578-74548600 AAGCAATCTGGTTTCTACCCTGG - Intergenic
992570393 5:78049473-78049495 AAGAAGTTTATTGTTTAGCCTGG + Intronic
992829124 5:80577403-80577425 AAGCAGATTGGTGGTTGCCTAGG + Intergenic
993355189 5:86897338-86897360 CAGCAGTTTAATGTTTACCCCGG + Intergenic
994447215 5:99892006-99892028 ATGCAGTTTGATTTTTCCCCAGG - Intergenic
994450215 5:99931430-99931452 AAGCAGAATGGTGTGAACCCAGG - Intergenic
995077700 5:108006173-108006195 TAGCAATATGGTGTTTATCCTGG - Intronic
995425396 5:112016059-112016081 AAGCAGATTAGTGTTTGCCAAGG + Intergenic
996401413 5:123067248-123067270 AAGCAGATTTGTGATTACCAGGG - Intergenic
996600332 5:125254847-125254869 AGGCAGTTTGTAATTTACCCTGG + Intergenic
996942374 5:129023806-129023828 ATGAATTTTGGTGTCTACCCGGG - Intronic
997414765 5:133717593-133717615 AAGCAGATTATTGTTTGCCCTGG - Intergenic
997438088 5:133889635-133889657 AAGGACTTTGGTTTTTACCCTGG - Intergenic
997778404 5:136631752-136631774 AAGCTGATTGGTGATTACCTGGG - Intergenic
998258748 5:140611407-140611429 GTGAAGTTTGGTGGTTACCCAGG + Intergenic
999275740 5:150328930-150328952 AAGGAGTTTGGGGTTTATTCCGG - Intronic
1003211297 6:4069798-4069820 AAGCAAGTTGGTCCTTACCCTGG - Exonic
1003379667 6:5611968-5611990 CAGGAGTTTGGTGGTTACACAGG - Intronic
1003829436 6:9990877-9990899 AAGCAGGTTGGTGTTTCCTGGGG + Intronic
1004743019 6:18481436-18481458 AAGAAGTTTTTTGTTTATCCTGG + Intergenic
1005005725 6:21285577-21285599 AAGCAGATTAGTGTTTGCCAGGG - Intergenic
1005311079 6:24559878-24559900 AAGCAGATTAGTGGTTGCCCGGG - Intronic
1006478043 6:34270610-34270632 AAGCAGATTAGTGTTTGCCCAGG + Intergenic
1008640364 6:53456212-53456234 AATAAGTTTGGTATTGACCCTGG + Intergenic
1009229760 6:61047962-61047984 AGGCAGTGTGGTGATTCCCCAGG - Intergenic
1011196826 6:84789389-84789411 AAGCAGATTAGTATTTACCTAGG + Intergenic
1011975285 6:93288371-93288393 AAGCAGTTTCGTGGTTGCCTAGG + Intronic
1013096733 6:106952239-106952261 AAGCAGAGTGGTGTTTGCCAGGG + Intergenic
1014380374 6:120733379-120733401 TAGCAGGTTAGTTTTTACCCTGG - Intergenic
1015774928 6:136804461-136804483 AAGCAGATTAGTGATTACCTGGG + Intergenic
1016366533 6:143324543-143324565 CAGCAGTTTAGTGTTCAGCCTGG - Intronic
1017047680 6:150362810-150362832 AAGCAGTCTGGAGGTTACCTGGG + Intergenic
1018697668 6:166403063-166403085 AAGCAGATTGGTGGTTGCCAAGG - Intergenic
1018957358 6:168419214-168419236 ATGCCATTTGATGTTTACCCAGG - Intergenic
1020725896 7:11814107-11814129 AAGTAGATTGGTATTTGCCCGGG + Intronic
1021204884 7:17768148-17768170 AAGTAGATTAGTGTTTACCAGGG - Intergenic
1021629212 7:22627463-22627485 AATCACTTTGGTGTTTTCCTTGG - Intronic
1021743445 7:23712282-23712304 AACCAGTTTGCTATTTACCTGGG - Exonic
1021840896 7:24721063-24721085 AAGCAGATTGGAGGTTACCGGGG + Intronic
1022374398 7:29800109-29800131 AAGCAGATTGGTGGTTGCCAGGG - Intergenic
1022616236 7:31933334-31933356 AAATACTTAGGTGTTTACCCTGG - Intronic
1022658809 7:32346898-32346920 AAGCAGTTTTGTGGTTATCTGGG + Intergenic
1024210405 7:47198384-47198406 AGGCAGTTTGGACTTTAACCTGG - Intergenic
1024494206 7:50024637-50024659 AAGTAGAATGGTGGTTACCCAGG + Intronic
1027957224 7:84896194-84896216 GAGCAGTTTTGTCTTTTCCCAGG + Intergenic
1030069025 7:105682752-105682774 AAGCAGATTGGTGATTAGCAGGG + Intronic
1032120643 7:129153197-129153219 AAGCAGATTTGTGGTTACCAGGG + Intronic
1033578758 7:142712363-142712385 AAGCAGTTCGTGGATTACCCAGG - Intergenic
1036906371 8:12711293-12711315 AAACAGGTCGGTGTTTCCCCGGG + Intergenic
1038738480 8:30194498-30194520 AAGCAGCTTGGTGGTTGCCAGGG - Intergenic
1041431533 8:57786495-57786517 AAGCATTTTGGTGTTTAAGCTGG - Intergenic
1041522058 8:58767845-58767867 AAGCAGTTTGGTGAATAGCCAGG - Intergenic
1042641575 8:70941137-70941159 AAGCAGATTGGTGGTTGCCAAGG - Intergenic
1045210193 8:100089498-100089520 AAGAAGTTTGGTGTTTAACCTGG - Intronic
1045873971 8:106957554-106957576 AAGCAGCTTGGTGGTTGCCAGGG - Intergenic
1046265194 8:111822112-111822134 AAGAAGTTTGTTTTTTACCGTGG - Intergenic
1049982923 9:921176-921198 AAGCAGATTAGTGATTACCAGGG - Intronic
1050891427 9:10829491-10829513 AAGCAGTTTGGTGTTGCACTGGG - Intergenic
1050935458 9:11389319-11389341 AAGCAGAATGGTGGTTACCAGGG + Intergenic
1051074450 9:13214388-13214410 AAGTAGATTGGTGGTTGCCCAGG + Intronic
1051710341 9:19924779-19924801 AGGCAGTTTGGTGGTTACTTTGG - Intergenic
1051813025 9:21072246-21072268 AAGCAGATTAGTGGTTACCTGGG - Intergenic
1056865433 9:90224432-90224454 AAACAGGTTGGTGTTTTGCCGGG - Intergenic
1057359372 9:94359268-94359290 AAGCAGATTGGTGGGTACCAGGG + Intergenic
1057648392 9:96898322-96898344 AAGCAGATTGGTGGGTACCAGGG - Intronic
1058912766 9:109536039-109536061 AAGCAGATTGGTGGTTGCCAGGG - Intergenic
1059388029 9:113980346-113980368 AAGCAGTTGGGGGTTTATGCAGG + Intronic
1059394179 9:114021745-114021767 AAGCAGATTAGTGTTTGCCTCGG - Intronic
1059594538 9:115704592-115704614 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1060120924 9:120988634-120988656 AAAAAGTTTGGTTTTTACTCTGG + Intronic
1060515807 9:124265032-124265054 AAGCAGATTGGTGGTTTCCAGGG + Intronic
1060702893 9:125774422-125774444 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1061546312 9:131306741-131306763 AAGCAGATTGGTGGTGTCCCAGG + Intronic
1062458281 9:136651105-136651127 AAGCAGCTTAGTGGTTACCAAGG - Intergenic
1186591477 X:10934459-10934481 AAGCAGATTAGTGGTTACCAGGG - Intergenic
1186889986 X:13950439-13950461 AAGCAGATTAGTGTTTGCCAGGG - Intergenic
1187351311 X:18520260-18520282 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1189332594 X:40152806-40152828 AAGAAGTTTTGTGTTTCCCCGGG - Intronic
1189729303 X:44002195-44002217 AAGCAGATTGGTGGTTGCCAGGG + Intergenic
1189961635 X:46330034-46330056 AACCAGTTGGGTGGTTACTCAGG - Intergenic
1191871582 X:65750915-65750937 AAGCAGCATAGTGTTTCCCCTGG + Intergenic
1192423216 X:71052571-71052593 TAACAGTTTGGTGTGTATCCTGG - Intergenic
1193358818 X:80556100-80556122 ATGAAGTTTGGTGATTACCCAGG - Intergenic
1194005319 X:88484420-88484442 AAGCAGATTAGTGGTTACCTAGG - Intergenic
1194107555 X:89790620-89790642 AAGCAGCTTAGTGGTTACCAGGG + Intergenic
1195939444 X:110155779-110155801 AAGAAGTTTGGTCTTCATCCTGG - Intronic
1196067935 X:111486348-111486370 AAGTAGATTAGTGTTTACCAAGG - Intergenic
1196761714 X:119206668-119206690 AAGCAGATTAGTGGTTGCCCGGG + Intergenic
1197256819 X:124272477-124272499 AAGCAGTTTGTTGGTTGCCAAGG + Intronic
1197764163 X:130048833-130048855 AAGCAGATTGGTGGTTGCCAGGG - Intronic
1200194722 X:154239963-154239985 AAGCAGATTGGTGGTTACCAGGG - Intergenic
1200312770 X:155096227-155096249 AAGCAGATTGGTGTTATCCTGGG + Intronic
1200459511 Y:3438405-3438427 AAGCAGCTTAGTGGTTACCAGGG + Intergenic
1201150504 Y:11093131-11093153 CTGAAGTTTGATGTTTACCCGGG - Intergenic
1202335628 Y:23807258-23807280 AAGGATTTTGGTGTTTTCACAGG + Intergenic
1202535139 Y:25862801-25862823 AAGGATTTTGGTGTTTTCACAGG - Intergenic