ID: 1164737000

View in Genome Browser
Species Human (GRCh38)
Location 19:30548961-30548983
Sequence GTTTGGTGTTTACCCAGGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164736994_1164737000 16 Left 1164736994 19:30548922-30548944 CCCTGCATTTTGTAACTTCCCAT 0: 1
1: 0
2: 3
3: 20
4: 298
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181
1164736997_1164737000 -3 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181
1164736993_1164737000 25 Left 1164736993 19:30548913-30548935 CCACGTGGACCCTGCATTTTGTA 0: 1
1: 0
2: 0
3: 13
4: 70
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181
1164736992_1164737000 29 Left 1164736992 19:30548909-30548931 CCGGCCACGTGGACCCTGCATTT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181
1164736996_1164737000 -2 Left 1164736996 19:30548940-30548962 CCCATCAGACTTCTACAAGCAGT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181
1164736995_1164737000 15 Left 1164736995 19:30548923-30548945 CCTGCATTTTGTAACTTCCCATC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164737000 Original CRISPR GTTTGGTGTTTACCCAGGCA TGG Exonic
902290383 1:15431253-15431275 GTCTGGGGTCTTCCCAGGCAGGG + Intergenic
902412277 1:16218373-16218395 GTTTGATGAATACCCAGGGATGG - Intergenic
905138927 1:35825334-35825356 GTTTGGTCTTTACCCTCGCCTGG - Exonic
905877360 1:41441119-41441141 GTTTCCTGTTTTCCCAGGCAGGG - Intergenic
906212613 1:44020580-44020602 GTTAGGTGAGTGCCCAGGCAGGG + Intronic
907742353 1:57179334-57179356 CTTTGGGGTTTCCCCAGTCACGG - Intronic
908500882 1:64743443-64743465 GATTGGTGTTTACCAAGGGCTGG - Intergenic
911255220 1:95625447-95625469 TCATGGTGTTTACACAGGCAGGG - Intergenic
912682212 1:111736617-111736639 AGTTTGTGTTTACACAGGCATGG - Intronic
912975762 1:114328791-114328813 CTGTGGTGTTGACACAGGCATGG + Intergenic
915271245 1:154755311-154755333 TTTTTGTATTTAGCCAGGCATGG + Intronic
916975304 1:170071224-170071246 TTTTGGTGTATACCTAGGCCTGG - Intronic
920511656 1:206556737-206556759 TATTGCTGTTTCCCCAGGCAGGG + Intronic
1063481139 10:6377706-6377728 GATTGGTGGTTACCCAGCTAAGG - Intergenic
1065001538 10:21342014-21342036 ATTTGGGGTTTACCTAGACAGGG + Intergenic
1067698355 10:48551457-48551479 TTTTCATGGTTACCCAGGCAAGG - Intronic
1068811449 10:61259982-61260004 GGTGGGTGTTTAGCCAGACAAGG - Intergenic
1069687016 10:70324826-70324848 GGCTGGTGTGTACCCAAGCATGG - Intronic
1073829961 10:107372387-107372409 CCTTGCTGTTTACCCAGACAGGG + Intergenic
1075109141 10:119563680-119563702 GTTTAGTGTATACCTAGGAATGG - Intergenic
1075328180 10:121551505-121551527 GTTTGGAGTTTACTCATGGAGGG - Intronic
1076350149 10:129810076-129810098 GTTTTGTGTTTCCCCATGGATGG + Intergenic
1076809299 10:132878429-132878451 GTTGGGGATGTACCCAGGCAGGG + Intronic
1077091601 11:780891-780913 GTGTAGTGTTTGGCCAGGCATGG + Intronic
1082281097 11:50272144-50272166 TTTTAGTGCTTACCCAGGCTTGG + Intergenic
1083304432 11:61755198-61755220 GCTTGGTGTGTGCCCAGGGAGGG - Intronic
1083560880 11:63671899-63671921 CTTTGGTGTTTAACTAGGCCTGG + Intronic
1084050214 11:66594478-66594500 GTTAAGTGTTTATCCAGGCCAGG + Intronic
1084471279 11:69360646-69360668 GATTGGTGTTGTCCAAGGCAGGG - Intronic
1084983644 11:72848187-72848209 GTTTGGTTTTTATCCTGGCTAGG - Intronic
1089737417 11:120559340-120559362 GTTGGGTGCTTACCCATGCTGGG + Intronic
1090732847 11:129586743-129586765 GGCTGATGTTTCCCCAGGCATGG + Intergenic
1095969719 12:47893323-47893345 GCTTTGTGTGTACCCAGGCTGGG - Intronic
1097199777 12:57268719-57268741 GTTTGGTCTTTATACAGCCATGG - Intronic
1098594185 12:72252504-72252526 GTGTGGTATTTGCCAAGGCATGG - Intronic
1099330424 12:81278250-81278272 GTTTTCTGTTTGGCCAGGCATGG + Intronic
1102377010 12:112430582-112430604 GTTTTGTAATTACCCAGGCATGG - Intronic
1105829825 13:24154190-24154212 GTTGGGTATTTACCCAGGAGTGG - Intronic
1106122576 13:26872869-26872891 TGTTGGTGTTTTCCCATGCACGG - Intergenic
1106961558 13:35004279-35004301 CTTGGGTGTATACCCAGGAATGG + Intronic
1107869951 13:44737156-44737178 GTTTAGTATTTACTCATGCATGG + Intergenic
1109571255 13:64193063-64193085 TTTTGGTGTATACCCAGTAATGG + Intergenic
1110045456 13:70823064-70823086 GATTGGTGATTAGCCAGGCCTGG - Intergenic
1111144417 13:84161735-84161757 GTTGGGTGTATACCCAGTAATGG + Intergenic
1111428421 13:88120570-88120592 TTTTGGTGTATACCCAGTAATGG + Intergenic
1112031916 13:95464601-95464623 CTTTGGTGTATACCCAGTAATGG + Intronic
1112235550 13:97632913-97632935 TTTTGGTATATACCCAGGAATGG + Intergenic
1112729223 13:102341125-102341147 GTTGGGTTTTTTCCCAGGCTAGG - Intronic
1115231262 14:31163285-31163307 GCCAGGTGTTTAGCCAGGCATGG + Intronic
1115724451 14:36198111-36198133 TTTGGGTATTTACCCAGGAAGGG - Intergenic
1118513344 14:66500654-66500676 GTTTGTTGTTAACTAAGGCATGG + Intergenic
1121083522 14:91127576-91127598 GTTTGCGGTTTGGCCAGGCAGGG + Intronic
1121644701 14:95509775-95509797 GTGTGGTGATCACCAAGGCATGG - Intergenic
1124349923 15:28947676-28947698 GTTCTGTGATGACCCAGGCAAGG - Intronic
1126261250 15:46695003-46695025 GTTTCTTGCTTACCTAGGCAGGG + Intergenic
1130284637 15:82544731-82544753 GTCTGGTGCTGACACAGGCATGG - Intronic
1131432694 15:92399385-92399407 GTCTAGTGTTTTCCCAGACAGGG - Intronic
1132423045 15:101690484-101690506 GTTTTGTGTTTGCACAGTCATGG - Intronic
1133119931 16:3599874-3599896 ATTTGGTGATTGGCCAGGCACGG - Intronic
1134294294 16:12931753-12931775 GGTGGGTATTTACCCAGTCATGG + Intronic
1142954048 17:3508390-3508412 GTTGGGTATATACCCAGTCATGG - Intronic
1143192425 17:5049756-5049778 TTTGGGTGTCTTCCCAGGCACGG + Intronic
1143277413 17:5722054-5722076 GTGTGGTGTATTCCCAGGCTTGG + Intergenic
1146965506 17:37025360-37025382 AATTGCTGTTTACCCAGGGAGGG + Intronic
1147797033 17:43051535-43051557 GTTTGATGTTTATCCAGACTTGG + Intronic
1148623696 17:49053433-49053455 GTGTGGTGTTTGCCAAGCCAAGG + Exonic
1151231662 17:72689432-72689454 GTATGGTGTATACCCAGGAGTGG - Intronic
1157467734 18:47961876-47961898 GATTGGTGGTTACCTAGGCCTGG - Intergenic
1157623466 18:49029397-49029419 GTTGGGAGTTTACCCTGGCTGGG + Intergenic
1160042373 18:75357417-75357439 GTTTGGGGTCAACCCAGGTAGGG - Intergenic
1164311769 19:24052128-24052150 GTTTGGGCTTTGCCCAAGCAGGG + Intronic
1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG + Exonic
1165013013 19:32862418-32862440 GTTTGGTGTGTGCCCGTGCAGGG + Intronic
1166635896 19:44451859-44451881 GTTTGGGGTTCACGCTGGCACGG + Intergenic
925186880 2:1853504-1853526 GTTTGGAGTTTACCCACATAAGG - Intronic
925733377 2:6939085-6939107 GTTGGGTGTTTACCTAGGTGTGG + Intronic
926241457 2:11090399-11090421 GTTGGGTGTATACCCAGGAGTGG - Intergenic
926836067 2:17022540-17022562 TTTGGGTATTTACCCAAGCATGG + Intergenic
927899247 2:26807254-26807276 TTTTGGTGATTAGACAGGCACGG - Intergenic
928614525 2:33023936-33023958 GTTTTGTGTTTAACCAGTAAAGG + Intronic
929655098 2:43723028-43723050 GTTTGCTGCTTATCAAGGCATGG + Intronic
929693509 2:44094345-44094367 GTTAGATGTTTCTCCAGGCAGGG - Intergenic
930301731 2:49624265-49624287 TTTTAGTGTTTACCTAGTCAGGG + Intergenic
930784460 2:55257800-55257822 GTTTGGGGTTTTCTGAGGCAGGG + Intronic
932109290 2:68980316-68980338 GCTTGGAATTGACCCAGGCAAGG - Intronic
932422166 2:71607691-71607713 GTTTGGTGATCAGTCAGGCAGGG + Intronic
935211438 2:100942290-100942312 GTTTTGTGTTAACACAGGCCAGG - Intronic
939247794 2:139647354-139647376 TTTTGGTGTATACCCAGTAATGG + Intergenic
941324382 2:164095080-164095102 GTTTGGTGTTTTCTCATGAATGG + Intergenic
941555323 2:166972272-166972294 GTTTGTTGTTTAGCCACCCAGGG + Intronic
942019370 2:171851071-171851093 ATTTGGTGTTTGCCTAGGAATGG - Intronic
943973397 2:194440400-194440422 CTTTGGTATATACCCAGGAATGG + Intergenic
945857431 2:215085340-215085362 GTGTGGTGTTAGCCCAGGCCTGG + Intronic
948587854 2:239030980-239031002 CTTGGGTATGTACCCAGGCATGG + Intergenic
1169301010 20:4441986-4442008 TTTTGGTATTTACCCAGCAATGG - Intergenic
1171887005 20:30661822-30661844 GCTTTGTGCTTGCCCAGGCACGG - Intergenic
1172201582 20:33130722-33130744 GTTGGGTGTGTACCCAGGAGTGG - Intergenic
1173183933 20:40825020-40825042 GATTGGTGGTTGCCTAGGCAGGG + Intergenic
1173386535 20:42593442-42593464 GTTAGGTGCTGACCCAGGCATGG + Intronic
1176902937 21:14465453-14465475 TTTTGGTGTATACCCAGTAATGG + Intergenic
1177454712 21:21321953-21321975 TTTTGGTATTTACCCAGTAATGG - Intronic
1179541151 21:42083929-42083951 GGTGGGTGTCTGCCCAGGCATGG + Intronic
1180254107 21:46610901-46610923 GTTTGCTGGTTGCCCAGGCCAGG - Intergenic
1183321947 22:37170256-37170278 GTTTGGTGTTTGCCAAGGTTGGG + Intronic
1183605754 22:38866070-38866092 GCTCGGTGTTGACCCAGGGATGG - Exonic
1184543317 22:45145478-45145500 TTTGGGTGTATACCTAGGCATGG + Intergenic
1184647664 22:45905031-45905053 TTTGGGTGTATACCCAGGAATGG + Intergenic
1185034315 22:48463531-48463553 ATTGGGTTTTTACCCAGGAAGGG - Intergenic
1185079760 22:48703244-48703266 GTGTGGTGTGTGGCCAGGCATGG + Intronic
953316652 3:41933757-41933779 ATGTGGTTTTTAGCCAGGCATGG + Intronic
953975999 3:47381875-47381897 GTTTGGCGTTGACTAAGGCAAGG + Intronic
955128076 3:56134669-56134691 GTTTTGTGTTTATGCAGGCAAGG - Intronic
956994955 3:74815555-74815577 GTTGGGTTTTTACCTAAGCATGG - Intergenic
961429202 3:126868404-126868426 GCTTGGAGCTTACCCAGCCATGG + Intronic
962104994 3:132381246-132381268 TTTGGGTGTATACCCAGTCATGG - Intergenic
962509809 3:136086718-136086740 CTTTGGTGTGTGGCCAGGCACGG + Intronic
962637084 3:137342493-137342515 GCTTGGGGTTGACCCAGCCAAGG + Intergenic
962891780 3:139678506-139678528 GTCTGGCGTTTACCAGGGCAGGG - Intergenic
962966483 3:140358885-140358907 CCTTGGTGTGTACCCATGCAGGG - Intronic
965702865 3:171476047-171476069 TTTTGGTGTATACCCAGTAATGG - Intergenic
966528875 3:180951214-180951236 GTTTGGTTTTTTTCCAGACAGGG - Intronic
971941899 4:33226220-33226242 TTTTGGTGTATACCCAGTAATGG + Intergenic
975031345 4:69621641-69621663 TTTCGGTGTATACCCAGGAATGG - Intronic
983991464 4:174125187-174125209 GTTTGGTGTTTAGGCAGGGATGG - Intergenic
1202767476 4_GL000008v2_random:161021-161043 GTTTTGTGCTTGGCCAGGCATGG - Intergenic
986128670 5:4907252-4907274 ATCTGCTGTTTACCAAGGCATGG + Intergenic
987317946 5:16741683-16741705 TTTTGCTGTTTCTCCAGGCACGG - Intronic
990370349 5:55111711-55111733 GTTTGGGATCTACCCAGGAATGG - Intergenic
992355070 5:75972817-75972839 TTTGGGTGTTTACCCAGTAATGG - Intergenic
993387873 5:87281085-87281107 TTTGGGTATATACCCAGGCATGG + Intronic
994095189 5:95841545-95841567 CTTTGGGGTTTCCCCAGCCAAGG + Intergenic
996811944 5:127525522-127525544 CTTGGGTGTCTACCTAGGCATGG + Intronic
997810615 5:136964215-136964237 CTTTGGTGATTGCCCATGCAAGG + Intergenic
998683909 5:144502753-144502775 GTTTGGTGCTTACTCAGGAAGGG + Intergenic
999525370 5:152399749-152399771 CTTTGGTATTTACCCAGGGTTGG + Intronic
1001822087 5:174718448-174718470 GTTTTCTGATTACCAAGGCAGGG + Intergenic
1001982618 5:176047137-176047159 GTCTGGTGTTTACCTAGGGATGG + Intergenic
1001982907 5:176048446-176048468 GTCTGGTATTTACCAAGGCTTGG + Intergenic
1002234845 5:177796920-177796942 GTCTGGTGTTTACCTAGGGATGG - Intergenic
1002819790 6:714008-714030 GTCTGGTCTTTTCCCAGGCTGGG + Intergenic
1003002678 6:2350671-2350693 TTTGGGTGTATACCCAGTCATGG + Intergenic
1003480603 6:6528616-6528638 GTTGGGTGTTTAGGCAGGCTTGG - Intergenic
1005129238 6:22485599-22485621 CTTTGGTGTTTGCCAAAGCATGG + Intergenic
1005866406 6:29940871-29940893 GTGTGTTGTTTTGCCAGGCATGG + Intergenic
1007418219 6:41704486-41704508 GGCTGGTGGTCACCCAGGCAGGG - Intronic
1012735878 6:102942380-102942402 GTTTGGTGTTGAGTCAGGTAGGG + Intergenic
1015622058 6:135141647-135141669 GTGTGCTGTTTAACCAGCCAAGG + Intergenic
1019217080 6:170451088-170451110 ATTTGGAGTTTTCCCAGGCCAGG + Intergenic
1021170006 7:17387606-17387628 TTTTGGTATATACCCAGGAATGG + Intergenic
1021706993 7:23377605-23377627 TTTGGGTGTATACCCAGGAATGG - Intronic
1022025806 7:26446657-26446679 TTTGGGTATATACCCAGGCATGG + Intergenic
1028031033 7:85913088-85913110 TTTTGGTATTTACCCAGTAATGG - Intergenic
1028698425 7:93745661-93745683 GTTTGGTATATACCCAGTAATGG - Intronic
1030576099 7:111287991-111288013 TTTTGATGTTTACCTATGCAAGG - Intronic
1030959591 7:115900235-115900257 TTTGGGTGTATACCCAGCCATGG - Intergenic
1031015655 7:116573720-116573742 GTTTGAAGTTTGCCCAGTCAAGG + Intergenic
1032599279 7:133275959-133275981 TTTTGGTTTTTTGCCAGGCATGG - Intronic
1035436236 7:158862077-158862099 GTTTGGTGTGTTGCCATGCAGGG + Intronic
1035966099 8:4193646-4193668 GTTTAGTATTTACCCAAACACGG + Intronic
1038089031 8:24233310-24233332 GCTTGGAGGTTACACAGGCAGGG + Intergenic
1040403295 8:47075017-47075039 GTTTGCTTTGTCCCCAGGCAGGG + Intergenic
1041001335 8:53457394-53457416 TTTGGGTGTATACCCAGGAATGG - Intergenic
1041441411 8:57901012-57901034 GCTTGGTGTGTTCCAAGGCAAGG + Intergenic
1043384015 8:79730817-79730839 GTTTGGTGGTTCCTCAGGAAAGG - Intergenic
1045210192 8:100089493-100089515 GTTTGGTGTTTAACCTGGCTTGG - Intronic
1047300292 8:123608372-123608394 TTTGGGTGTATACCCAGGAATGG + Intergenic
1048149304 8:131878198-131878220 TTTTGGTGTATACCCAGTAATGG + Intergenic
1052221059 9:26022974-26022996 TTTTGGTGTATACCCAGTAATGG + Intergenic
1052753261 9:32514216-32514238 GTTTGGTATATACCCAGTAATGG - Intronic
1054203439 9:62107928-62107950 CTTTGGTATATACCCAGGAATGG - Intergenic
1054634923 9:67480436-67480458 CTTTGGTATATACCCAGGAATGG + Intergenic
1058426754 9:104882157-104882179 GTTTGGTGTTTAGGGAGGGATGG - Intronic
1059140700 9:111850427-111850449 GTTTGGACTTTATCCAGGTAGGG + Intergenic
1203548231 Un_KI270743v1:145894-145916 GTTTTGTGCTTGGCCAGGCATGG - Intergenic
1185523560 X:759996-760018 TTTGGGTGTGTACCCAGTCATGG - Intergenic
1185718050 X:2359240-2359262 TTTGGGTATATACCCAGGCATGG - Intronic
1187670882 X:21664926-21664948 GGGTGGTGTTTAGCAAGGCAGGG - Intergenic
1188160042 X:26788591-26788613 GAATGGTGGTTACCAAGGCAGGG - Intergenic
1189961633 X:46330029-46330051 GTTGGGTGGTTACTCAGGCTAGG - Intergenic
1190863292 X:54363558-54363580 TTTTGCTGTCTACCCAGGGATGG + Intergenic
1191749499 X:64526647-64526669 GTTTGGTATATACCCAGTAATGG - Intergenic
1191850825 X:65584807-65584829 GTTGGGTGTATACCCAGCAATGG + Intergenic
1191937560 X:66441601-66441623 GTTTGGAATCTACCCAGGCAAGG - Intergenic
1192679312 X:73235212-73235234 TTTTGGTGTATACCCAGTAATGG - Intergenic
1193319114 X:80099090-80099112 GTGTGGTGTGTGGCCAGGCAAGG + Intergenic
1195980388 X:110571195-110571217 GATTTGTGTTTTCCCAGGCCTGG + Intergenic
1196809737 X:119619657-119619679 GATCGGTGGTTACCCAGCCATGG + Intronic
1197525866 X:127561933-127561955 TTTTGGTGTATACCCAGTAATGG + Intergenic
1197642607 X:128983670-128983692 CTTTGGTTTATACCCAGGAATGG - Intergenic
1197938962 X:131768691-131768713 GTTTGTTGTTTCCTTAGGCATGG - Intergenic
1199612274 X:149628664-149628686 GTTTGGTGGGTCCCAAGGCATGG - Intronic
1202110295 Y:21410013-21410035 CTTTGGTGTTTGTCCAGGGAGGG + Intergenic