ID: 1164737001

View in Genome Browser
Species Human (GRCh38)
Location 19:30548965-30548987
Sequence GGTGTTTACCCAGGCATGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164736993_1164737001 29 Left 1164736993 19:30548913-30548935 CCACGTGGACCCTGCATTTTGTA 0: 1
1: 0
2: 0
3: 13
4: 70
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1164736996_1164737001 2 Left 1164736996 19:30548940-30548962 CCCATCAGACTTCTACAAGCAGT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1164736995_1164737001 19 Left 1164736995 19:30548923-30548945 CCTGCATTTTGTAACTTCCCATC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1164736997_1164737001 1 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1164736994_1164737001 20 Left 1164736994 19:30548922-30548944 CCCTGCATTTTGTAACTTCCCAT 0: 1
1: 0
2: 3
3: 20
4: 298
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164737001 Original CRISPR GGTGTTTACCCAGGCATGGT TGG Exonic
900575572 1:3380675-3380697 GATGTTTACCCTGGCAGGGGAGG + Intronic
903830534 1:26171545-26171567 GGTGTCAACCCAGCTATGGTAGG + Exonic
904619980 1:31769524-31769546 TGTGTTTACACAGACATGGAAGG - Intergenic
908563916 1:65334972-65334994 GGTGTTTACCAAAGGGTGGTAGG - Intronic
910500139 1:87880838-87880860 AGTGTTTGCCCATCCATGGTTGG - Intergenic
913214517 1:116609409-116609431 GGTGCTTAACCAGGCATGAGGGG + Intronic
918091153 1:181296264-181296286 GGTCTTTTCCTAGCCATGGTGGG + Intergenic
921178209 1:212611070-212611092 AGTGTTTACCCAGCCAGGGGAGG + Intronic
921384212 1:214552483-214552505 AGTGCCTACCCAGGCAGGGTGGG - Intergenic
1066261182 10:33731048-33731070 AATGTTAAGCCAGGCATGGTGGG + Intergenic
1069065700 10:63939550-63939572 GGTGTTTAGCCAGGGTTGGAGGG + Intergenic
1070206533 10:74268609-74268631 GGTTATTACCCAGACATGTTTGG + Intronic
1073119034 10:101110316-101110338 GATAATTAGCCAGGCATGGTGGG + Intronic
1076806059 10:132859332-132859354 GGTGTTCATCCAGGGATGCTCGG + Intronic
1077072567 11:682755-682777 AGGCTTTACCCAGGCATGGGAGG - Intronic
1077248046 11:1548624-1548646 GGTGACTACCCAGGAAGGGTAGG - Intergenic
1080915769 11:36657081-36657103 GGCCTTTACCCAGGCATGAAAGG + Intronic
1083151419 11:60794103-60794125 GGTGAGTACCCAGGCCTGGAGGG + Exonic
1084656319 11:70521728-70521750 GCTGTTTACCCAAGGAAGGTGGG - Intronic
1087641221 11:100756097-100756119 CGTCTTTGGCCAGGCATGGTGGG + Intronic
1089275712 11:117334632-117334654 AGAGATTAGCCAGGCATGGTGGG + Intronic
1093207454 12:16267888-16267910 TTTAATTACCCAGGCATGGTGGG - Intronic
1095694416 12:45128513-45128535 GGCATTCACCCTGGCATGGTGGG + Intergenic
1100479957 12:94968397-94968419 GATGTTGACCAAGGCATGATAGG + Intronic
1102111747 12:110370630-110370652 GCTGTTTGCCCAGGCCTGGAGGG + Intergenic
1103926024 12:124423687-124423709 GGGGTTTCCCCAGGCACAGTGGG + Intronic
1105218246 13:18302881-18302903 GGTGTTTAACCAGGCATGAGGGG + Intergenic
1105869399 13:24490756-24490778 GGTATTTGGCCAGGGATGGTGGG + Exonic
1107581112 13:41787522-41787544 GGTTTTTACCCAGTCTTGCTAGG - Exonic
1116995509 14:51319564-51319586 GAGATTTGCCCAGGCATGGTAGG - Intergenic
1119240132 14:73052549-73052571 TGTAATTAGCCAGGCATGGTGGG - Intergenic
1119853808 14:77884599-77884621 GGTGGGTACTCAGGCATGGCTGG + Intronic
1121981688 14:98460069-98460091 AGTTTTCAGCCAGGCATGGTGGG + Intergenic
1122974522 14:105165628-105165650 GCTGTTGACCCAGGCCTGGCTGG - Intronic
1123475801 15:20592102-20592124 GGTCTGTACCCAGGCCTGGCGGG - Intergenic
1123642209 15:22408261-22408283 GGTCTGTACCCAGGCCTGGCGGG + Intergenic
1125342299 15:38686891-38686913 CATGTTTTACCAGGCATGGTGGG + Intergenic
1127643102 15:60933663-60933685 TGTGTATACCCTGGCATGATGGG - Intronic
1128667320 15:69548026-69548048 GATCTTTACCAAGGCAAGGTGGG + Intergenic
1134186175 16:12086698-12086720 GGTGTTTGGCCAGGCATAGTAGG - Intronic
1140432489 16:74916412-74916434 GGTGTTTAACCAGGGAGAGTTGG - Intronic
1142215890 16:88829625-88829647 GGGGACTGCCCAGGCATGGTGGG + Intronic
1142708043 17:1708909-1708931 GGTGGGTGCCCTGGCATGGTGGG + Intronic
1142708051 17:1708943-1708965 GGTGAGTGCCCTGGCATGGTAGG + Intronic
1143657872 17:8307326-8307348 GCAGTTTAGCCAGGCAAGGTGGG - Intergenic
1148082046 17:44972228-44972250 GCTTTTTACCCAGGCATGACTGG + Intergenic
1153190734 18:2535138-2535160 GGTGCTTACCAAGACATGGTAGG + Intergenic
1153223057 18:2878723-2878745 GGTGTTTCCCCAGGGATGGTAGG - Intronic
1155438160 18:25834232-25834254 GGTGGTTCCCCAAGCATGGCTGG - Intergenic
1157467730 18:47961872-47961894 GGTGGTTACCTAGGCCTGGGGGG - Intergenic
1162328429 19:10012113-10012135 GGTGTTTCCCCAGGGAGGGGAGG + Intergenic
1163928412 19:20366378-20366400 GGTGTTTAGCCAGTCCTGGAGGG - Intergenic
1164010113 19:21194729-21194751 GGGGTTGGGCCAGGCATGGTGGG - Exonic
1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG + Exonic
1165726175 19:38114658-38114680 GGTTTCTACCAAGGTATGGTGGG - Intronic
925382752 2:3438280-3438302 GGGGTTAATCCAGGGATGGTGGG - Intronic
926715502 2:15920776-15920798 GGAGTTTCCCCAGGCAGGGAAGG + Intergenic
927055017 2:19359173-19359195 GGTGTTAACCCAGGCAGCGCTGG + Intergenic
930253611 2:49064083-49064105 TGTGTTTGCACATGCATGGTGGG + Intronic
933041683 2:77476260-77476282 GATGTTTACACAAGCATGATTGG - Intronic
934136414 2:89000374-89000396 GGTGTTTATCCAGGCACAGCAGG + Intergenic
934143088 2:89067639-89067661 GGTGTTTATCCAGGTATAGCAGG + Intergenic
934226155 2:90132916-90132938 GGTGTTTATCCAGGTATAGCAGG - Intergenic
934296053 2:91743751-91743773 GGTGTTTAACCAGGCGTGAGGGG - Intergenic
935006750 2:99086396-99086418 GGGGTTTACCCAGGCATGCCAGG + Intronic
935114772 2:100125878-100125900 CAGGTTTACACAGGCATGGTAGG + Intronic
938257699 2:129872565-129872587 GGTCTTTACCCAGGTGTGGCTGG + Intergenic
938554802 2:132415323-132415345 GGTGGTTACCAAGGCCTGGGAGG - Intergenic
945167670 2:206963187-206963209 TGTGTTTACCCAAGCACTGTTGG + Intronic
946537787 2:220650182-220650204 GTCATTTACCCAGGCATTGTAGG + Intergenic
946899803 2:224361358-224361380 GGCATTTGCCCAGACATGGTGGG - Intergenic
1172650715 20:36499805-36499827 GGTGGTGGCCCAGGCATGGGAGG + Intronic
1172939037 20:38642063-38642085 TGTGTTTACCCATCCATGCTTGG - Intronic
1177586382 21:23101666-23101688 GGTGTTTGCTCAGGCAGGATGGG + Intergenic
1179921998 21:44512480-44512502 GGTATTTCCCTAGGCATGGGTGG + Intronic
1180600735 22:17013422-17013444 GGAGTTTGGCCAGGCCTGGTGGG + Intergenic
1184711691 22:46254308-46254330 GGAGTTTTTCCAGGCATGTTGGG - Intergenic
1185291172 22:50028579-50028601 GGTCTTTACGAGGGCATGGTGGG - Intronic
950648470 3:14392532-14392554 GGTGTGTACCCAGGCTTAGGGGG + Intergenic
956630322 3:71310831-71310853 TGTGTTAACCTAGGCCTGGTAGG - Intronic
956641814 3:71422836-71422858 TGTGTGTACCCAGAAATGGTAGG - Intronic
956779633 3:72593808-72593830 GGTCTTTACCCAGTGATGGAGGG + Intergenic
957489097 3:80900191-80900213 GTTGTCTAACCAGGCATGGTAGG - Intergenic
957807947 3:85175564-85175586 GGTGGTTACCAAGGGCTGGTGGG + Intronic
960545286 3:118907103-118907125 GGTGTTGCCCCAGGCATACTTGG - Intronic
964277576 3:155024210-155024232 TGTGTATCCCCAGCCATGGTAGG - Intronic
965357786 3:167698382-167698404 ACTTTTTAGCCAGGCATGGTGGG + Intronic
966673936 3:182564507-182564529 TGTGTTTATCCAGGCCAGGTGGG - Intergenic
975699579 4:77050194-77050216 GGTGTTTAGCCAGTCCTGGAAGG - Intronic
979178020 4:117689512-117689534 GTTGTGTACCCAGGCACAGTAGG + Intergenic
981637690 4:146899261-146899283 GGTGTTTCCCCAGTCATGTCTGG + Intronic
982178165 4:152726021-152726043 GGGGTTGTCCCATGCATGGTTGG - Intronic
983917614 4:173309400-173309422 GGTGATTATCCAGCCATGTTGGG + Intronic
984104313 4:175526074-175526096 GGTGTTTTCCAGGGAATGGTGGG - Intergenic
986163204 5:5249962-5249984 GGAGTTCAGCCAGGGATGGTTGG - Intronic
989545632 5:42669549-42669571 AGTTTTTAGCCAGGAATGGTAGG - Intronic
992025269 5:72663602-72663624 GGTGTTCTCCCAGGCAGGTTAGG + Intergenic
995665873 5:114541505-114541527 GGTATATACCCAGTAATGGTTGG + Intergenic
997461146 5:134053369-134053391 AGAGTATCCCCAGGCATGGTGGG - Intergenic
998654400 5:144160548-144160570 GTTGTTTACAGAGGAATGGTAGG - Exonic
1001406241 5:171479653-171479675 GGGGTTTCCCCAGGCAGGATGGG + Intergenic
1001929178 5:175660532-175660554 AGTGTTTGCCCATGGATGGTGGG + Intronic
1002454222 5:179337165-179337187 GGTGGTTACCCCGGAATGGGAGG - Intronic
1003208449 6:4036701-4036723 GATTTTTGCCCGGGCATGGTGGG + Intronic
1004481707 6:16025675-16025697 GGTGTTTACCCAAGCTTAGTAGG - Intergenic
1005738668 6:28771699-28771721 GGTGTTTAGCCAGTCCTGGGGGG + Intergenic
1005849732 6:29812660-29812682 GGTGTTGACCCAGGCCTTGCAGG + Intergenic
1006576097 6:35047553-35047575 ACTTTTCACCCAGGCATGGTGGG - Intronic
1010692308 6:78924804-78924826 GGTATATACCCAGTAATGGTTGG - Intronic
1012113495 6:95263576-95263598 GGAGTTTGGCCAGGGATGGTTGG - Intergenic
1016755488 6:147680824-147680846 GGGGTTTACCCAGGAATGCAAGG - Intronic
1017940313 6:159047144-159047166 GGTGCTTAACTAGGCATGGTAGG - Intergenic
1023877406 7:44294447-44294469 AGTGCTTGCCCAGGGATGGTGGG + Intronic
1024635732 7:51288599-51288621 AGTAATTAGCCAGGCATGGTTGG + Intronic
1029147899 7:98459539-98459561 GTTGGTTACCCAGGTATAGTAGG + Intergenic
1029344670 7:99969960-99969982 GGTGTTTACCCAGCACTGGTTGG + Intronic
1029558353 7:101286032-101286054 GGTGTTTACCCAGCACTGGTTGG + Intergenic
1032104722 7:129017709-129017731 TGTGTTTTCACAGGCATGCTAGG - Intronic
1032599277 7:133275955-133275977 GGTTTTTTGCCAGGCATGGTGGG - Intronic
1033571006 7:142628097-142628119 GGTGTGTACCTAGGCATAGAGGG - Intergenic
1033963572 7:146945573-146945595 GTTCTTTCCCCAGGCTTGGTCGG + Intronic
1035176170 7:157052997-157053019 TGAGTATACACAGGCATGGTAGG - Intergenic
1036656301 8:10679556-10679578 GGAGTTTACCCAGGGCTGGAGGG - Intronic
1039886473 8:41656820-41656842 GGTGGTTCCCCAGGGATGGGAGG + Intronic
1043110838 8:76178783-76178805 GGTATTCGGCCAGGCATGGTGGG - Intergenic
1044692068 8:94890878-94890900 GTTTTTTAGCCGGGCATGGTGGG - Intronic
1045217441 8:100162513-100162535 TGTTTTTGCCCATGCATGGTAGG + Intronic
1052815870 9:33102228-33102250 GGTGTTGGCCCAGGCAGGGCAGG + Intergenic
1053413221 9:37929017-37929039 GGGGTTGACCCAGGCAGGGCTGG + Intronic
1055752576 9:79523035-79523057 AGTGTTAACCCAAGCATGCTTGG - Intergenic
1059764418 9:117370353-117370375 GGTGTTCACCGAGGCATTGCTGG - Intronic
1185635249 X:1547349-1547371 TGTGTTCACCCAGGCCTGGGTGG + Intergenic
1195980390 X:110571199-110571221 TGTGTTTTCCCAGGCCTGGAGGG + Intergenic
1199373188 X:147075376-147075398 AGTGTTTGGCCAGGTATGGTTGG - Intergenic
1201495249 Y:14585958-14585980 GGTTGTTACCCAGGGATGGAAGG + Intronic