ID: 1164737002

View in Genome Browser
Species Human (GRCh38)
Location 19:30548971-30548993
Sequence TACCCAGGCATGGTTGGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164736996_1164737002 8 Left 1164736996 19:30548940-30548962 CCCATCAGACTTCTACAAGCAGT 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1164736997_1164737002 7 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1164736994_1164737002 26 Left 1164736994 19:30548922-30548944 CCCTGCATTTTGTAACTTCCCAT 0: 1
1: 0
2: 3
3: 20
4: 298
Right 1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1164736995_1164737002 25 Left 1164736995 19:30548923-30548945 CCTGCATTTTGTAACTTCCCATC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164737002 Original CRISPR TACCCAGGCATGGTTGGCTC AGG Exonic
900474620 1:2870283-2870305 TACCCAGGGAGGGCTGGCCCCGG - Intergenic
900976539 1:6020304-6020326 TCCCCAGACAGGGCTGGCTCGGG + Intronic
904155430 1:28479128-28479150 TAGCCAGGCATGGCTGGCCACGG + Intronic
905166187 1:36084504-36084526 CAACAAGGCATGGTTGGCTGGGG + Intronic
905942196 1:41873119-41873141 TTCCCAGGCAGGGTCTGCTCAGG + Intronic
912670538 1:111620140-111620162 TCCGCGGGCGTGGTTGGCTCTGG - Intronic
913970184 1:143409054-143409076 TACCCAGGCATGGTGGCGTGTGG - Intergenic
914064559 1:144234651-144234673 TACCCAGGCATGGTGGCGTGTGG - Intergenic
914114591 1:144731703-144731725 TACCCAGGCATGGTGGCGTGTGG + Intergenic
915145654 1:153794544-153794566 CAGCCAGCCTTGGTTGGCTCAGG - Intergenic
917584284 1:176410105-176410127 TGCCTAGGCATGGCTGGCTGTGG + Intergenic
917958690 1:180125707-180125729 CACCCAGGAATGGTGGGCCCGGG + Intergenic
918366684 1:183815475-183815497 TAGCCAGGCCTTGATGGCTCTGG - Intronic
920313901 1:205064572-205064594 AACTCAGGCATGGTTGTCCCTGG - Intronic
922718531 1:227888900-227888922 AAGCCAGGCATGCATGGCTCAGG + Intergenic
922802942 1:228372331-228372353 TACGCAGGCGTGGCTGGCTATGG + Exonic
1067384196 10:45803876-45803898 TACCCTGGCATGCTCGGTTCTGG - Intergenic
1067880001 10:50034934-50034956 TACCCTGGCATGCTCGGTTCTGG + Intergenic
1067891882 10:50144446-50144468 TACCCTGGCATGCTCGGTTCTGG - Intergenic
1070524253 10:77281621-77281643 TTCCCAGGCATGGCTGGAGCAGG - Intronic
1071064505 10:81614587-81614609 AAGCCAGGCAAGCTTGGCTCAGG - Intergenic
1071499506 10:86193447-86193469 GACCCTGGCATGGTTTCCTCAGG - Intronic
1074413392 10:113246832-113246854 TACCCAGGCAGTCTTGACTCTGG - Intergenic
1080639850 11:34152322-34152344 TACCCCGACATGGTGGGCCCTGG + Exonic
1082128229 11:48456732-48456754 AAGCCAGGCATGGCTGGGTCTGG + Intergenic
1082249190 11:49960686-49960708 AAGCCAGGCATGGCTGGGTCTGG - Intergenic
1085417925 11:76331604-76331626 TAGCCAGGCATGGCTGGGTGCGG - Intergenic
1085504942 11:77053090-77053112 TTCCCAGGCTTGTTTGGCCCCGG - Intergenic
1089549943 11:119266055-119266077 TAGCCAGGCATAGTGGCCTCTGG + Intronic
1092439758 12:8489457-8489479 TAGCCAGGCATGGTTACCTGGGG + Intergenic
1095423594 12:42050879-42050901 TAGCCAGGCATGGTGGGGTGTGG + Intergenic
1096232259 12:49903192-49903214 TGGCCAGGCATGGATGGGTCCGG - Intronic
1102235186 12:111290003-111290025 CACACAGGCATGGTTGGCAGAGG + Intronic
1103081683 12:118029029-118029051 GCCCAAGGTATGGTTGGCTCAGG + Intronic
1104566813 12:129892770-129892792 TACAAAGGCATGGATGGCCCAGG - Intronic
1104611009 12:130227893-130227915 TGCCCAGGCTTGTTTGGATCCGG - Intergenic
1107469916 13:40682284-40682306 TAGCCAGGCATGGTTGGGGGCGG - Intergenic
1110855832 13:80295892-80295914 TAGCCAGGCGTGGTTGGGTGGGG - Intergenic
1114176283 14:20323434-20323456 TAGCCAGGCATGGTGGCCTGTGG + Intronic
1117062778 14:51980328-51980350 TGCCCAGGCTTGGTTGGATGTGG + Intergenic
1118410225 14:65470406-65470428 CACCCAGGCTTGGGTGGCTTGGG + Intronic
1120815991 14:88858731-88858753 TATCCAGGCATGGTGGCCTGTGG - Intronic
1121264470 14:92590680-92590702 TTCCCAGGCAGGTTAGGCTCTGG - Intronic
1121885947 14:97542743-97542765 TACCCTGGGATGCTTGGCTCAGG + Intergenic
1122212679 14:100182821-100182843 TAGCCAGGCATGGTTGGGCGTGG + Intergenic
1122412334 14:101532018-101532040 AACCCAGGCAGGGATGCCTCAGG + Intergenic
1123943596 15:25228379-25228401 TACCTAGGCGTGGTGGGCGCTGG - Intergenic
1125618565 15:41038158-41038180 TAGCCAGGCATGGTGGCCTGTGG - Intronic
1125791848 15:42373041-42373063 TAGCCAGGCATGGTGGTGTCTGG + Intronic
1127583268 15:60356995-60357017 TATGCAGGCAAGGTTGGCTGTGG - Intronic
1128130459 15:65223885-65223907 TAACCAGGCATGGTGGCCTGTGG - Intergenic
1130062188 15:80578090-80578112 CACCCAGGCAGGGCTGGCACAGG - Intronic
1130167911 15:81482015-81482037 TACCCAGACAGGGCTGGCTCGGG - Intergenic
1132842710 16:1986059-1986081 TAGCCAGGCATGGTTGGATAGGG + Exonic
1134109646 16:11507092-11507114 TCCCCTGGCAGGGGTGGCTCAGG - Intronic
1134283566 16:12839675-12839697 TAGTCAGGCATGGTGTGCTCAGG - Intergenic
1135200269 16:20431125-20431147 CACACAGGCCTGGTTGGCACGGG + Intronic
1137981328 16:53072524-53072546 TAGCCAGGCATGGTGGGGTGGGG - Intronic
1139381108 16:66531562-66531584 TACACAGGCAGGGTTGGGGCTGG + Intronic
1142731425 17:1861062-1861084 AACACAGGCATGGTTCCCTCTGG + Intronic
1144220752 17:13097702-13097724 TACCCAGGACTGGGTGGTTCTGG + Intergenic
1145061953 17:19739151-19739173 TACCCAGGCAGGGTCGGGTTGGG - Intronic
1145925381 17:28643110-28643132 TACTTTGGCATGGTTGGCTTTGG - Intronic
1147836117 17:43333089-43333111 AACCGGGGCATGGTAGGCTCTGG + Intergenic
1148038467 17:44687150-44687172 TAGCCAGGCATGGCTGGGTGTGG + Intronic
1148071303 17:44910446-44910468 TACCCTGGTATGATAGGCTCTGG + Exonic
1148471577 17:47896640-47896662 GACCCAGGCATAGTTCGCCCAGG - Intronic
1150346200 17:64406449-64406471 CCTCCAGGCATGGTGGGCTCTGG - Intronic
1151099417 17:71539717-71539739 TTCCCAGCCAGGGTAGGCTCAGG + Intergenic
1151357895 17:73571294-73571316 GCCCCAGGCATGGTGGGCTGTGG + Intronic
1151899492 17:77002335-77002357 TGCCCTGGCCTGGTTGGCTGCGG + Intergenic
1153013836 18:565545-565567 TACTCAGGTATGGTGGGCACTGG - Intergenic
1154934718 18:21041148-21041170 TAGCCAGGCATGGGTGGCTCAGG + Intronic
1155004784 18:21718908-21718930 TAGCCAGGCATGGCTGGGTGTGG + Intronic
1156587871 18:38452269-38452291 TAGCCAGGCATGGTGGCCTGTGG + Intergenic
1158504299 18:58032426-58032448 TCCCCGAGCATGGTTGCCTCTGG - Intergenic
1160054689 18:75467326-75467348 TAGCCTGGCTTGGTGGGCTCAGG + Intergenic
1160606067 18:80050221-80050243 TACCCTGGCCTGGGTGGCACAGG - Intronic
1162818627 19:13210091-13210113 TACCCAGGCACTGGAGGCTCTGG + Intronic
1163162871 19:15475937-15475959 TTCCCAGGTCTGGATGGCTCTGG + Exonic
1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG + Exonic
1165354243 19:35293893-35293915 AACCCAGTCATTGATGGCTCTGG + Intronic
1166725676 19:45025801-45025823 TACAGAGGCATGAATGGCTCAGG + Intronic
925628959 2:5869227-5869249 TCCCCAGGCGTGGTTGCCTCTGG + Intergenic
927031150 2:19121767-19121789 TGCCCAGGCATGGTGGGCAAGGG - Intergenic
928218104 2:29379185-29379207 AGCCCAGGCATGGGTGTCTCTGG + Intronic
929689339 2:44061583-44061605 TTCCCAGGCAGGGTGGCCTCTGG + Intergenic
930081547 2:47453323-47453345 TACCCAACCATGGTTACCTCGGG - Intronic
934174877 2:89569966-89569988 TACCCAGGCATGGTGGCGTGTGG - Intergenic
934285194 2:91644318-91644340 TACCCAGGCATGGTGGCGTGTGG - Intergenic
940122131 2:150278475-150278497 TAGCCAGGCATGGCTGGGGCAGG + Intergenic
948692101 2:239712466-239712488 GACCCACTCATGGTTGCCTCTGG - Intergenic
1169123316 20:3110189-3110211 CACCCAGGCAGGGTCGGCACAGG + Exonic
1171216305 20:23354989-23355011 CACTCAAGCATGGTTGGGTCTGG - Intergenic
1173361739 20:42350712-42350734 TACTCAGGCATGGATGGAGCTGG + Exonic
1173953298 20:47010405-47010427 TCTTCAGGCATGGTGGGCTCAGG + Intronic
1177253223 21:18623995-18624017 TACACAGGCATGGCAGGCTCTGG + Intergenic
1178538272 21:33428366-33428388 TAGCCAGGTGTGGTTGGCACAGG - Intronic
1179169213 21:38959739-38959761 AACCCAGGCGCGGTGGGCTCAGG - Intergenic
1181563004 22:23716662-23716684 TAGCCAGGCATGGTGGTCCCAGG + Intergenic
1183390377 22:37542289-37542311 GACCCAGGGGTGGTAGGCTCAGG - Intergenic
1183701524 22:39453889-39453911 CACCCAGGCCTTTTTGGCTCTGG - Intergenic
952716825 3:36488353-36488375 TGCCCAAGCATGAGTGGCTCTGG - Intronic
953439804 3:42907501-42907523 AACCCAGGCCTGTTTGACTCTGG - Intronic
954252717 3:49380557-49380579 TACCCAGGCGTGGTGGGGTGAGG + Intronic
954704205 3:52470403-52470425 TTCCCAGGGAGGGTTAGCTCTGG + Intronic
955938218 3:64122802-64122824 TACCCTGGCTGGGTTGGCACAGG - Intronic
961463672 3:127068725-127068747 TCCCCAGGCATGGTAGGATGTGG - Intergenic
961571450 3:127802122-127802144 GACCCTGACATGCTTGGCTCAGG - Intronic
961627432 3:128273754-128273776 GGCCCAGGCATGGTTGGAGCAGG + Intronic
962274039 3:133998876-133998898 TCCCCTGGCATGGCCGGCTCAGG + Intronic
962447521 3:135480430-135480452 AACCCAGGCAAGTTTGGCCCTGG + Intergenic
965357788 3:167698388-167698410 TAGCCAGGCATGGTGGGGTGTGG + Intronic
968522569 4:1040682-1040704 CACCCAGGCAGGGTGGGCTGCGG + Intergenic
968570097 4:1334792-1334814 TCCCCAGGACTGGTTGCCTCTGG - Intronic
969427709 4:7135419-7135441 TCCCCAGTCATGCTTGGCTCTGG + Intergenic
969511195 4:7618908-7618930 CACACAGGCATGGATGGCACAGG - Intronic
969537501 4:7765702-7765724 TTCCCTGGCATGGATGGCTCTGG + Intronic
971819957 4:31539251-31539273 GACCCAGGCAGGGTTGGGCCAGG + Intergenic
973144243 4:46804942-46804964 TGCTCAGGCATGGTGGGCTGCGG + Intronic
974661097 4:64889655-64889677 TATCCAGGAATTGATGGCTCTGG + Intergenic
975759260 4:77602588-77602610 TACCCAGTTATGCTTGGGTCTGG + Intronic
977121981 4:93113702-93113724 CAACCAGACATGGCTGGCTCTGG - Intronic
980129803 4:128808022-128808044 TAGCCAGACATGGCTGGATCTGG - Intergenic
982209403 4:153022469-153022491 TGCCCAGGTGTGGGTGGCTCAGG - Intergenic
982251794 4:153414429-153414451 TAGCCAGGCATGGTTGGTGGCGG - Intronic
985703005 5:1384819-1384841 TGCCGAGGCCTGGTTTGCTCCGG - Intergenic
986952286 5:13103328-13103350 TTCCCAGGCATGGTTTGATAGGG + Intergenic
987341670 5:16944851-16944873 TAGCCAGGCATGGTGGGCTAAGG - Intergenic
991686412 5:69186210-69186232 TAGCCAGGCATGGTGGCCTGTGG + Intergenic
992635040 5:78718860-78718882 GACCCAGGCCTGGTGGGCCCTGG + Intronic
992795899 5:80255295-80255317 TACCGAGCCAGGGTTGGGTCGGG + Intronic
993873233 5:93276348-93276370 CACCCACGCATGGTTTGCTCTGG + Intergenic
995827896 5:116321665-116321687 GACCCAGGCCTGATTGGATCAGG - Intronic
997461144 5:134053363-134053385 TCCCCAGGCATGGTGGGTGCGGG - Intergenic
998363415 5:141611128-141611150 TAGCCAGGCATGGTGGTCCCAGG + Intronic
1001252094 5:170154316-170154338 CACCCAGGCCTGGTGGTCTCAGG - Intergenic
1002938433 6:1694892-1694914 TTCCAAAGCAGGGTTGGCTCTGG - Intronic
1003539970 6:7010034-7010056 TAGCCAGGCATGGTGGCCTGTGG + Intergenic
1003936124 6:10976907-10976929 CACGCAGGCCTGGTTGGCTGAGG - Intronic
1006779124 6:36620108-36620130 TAGCCAGGCATGGCTGGGTGCGG + Intergenic
1008537163 6:52515201-52515223 GACCCAGGCATGGATTTCTCAGG + Intronic
1008732192 6:54495705-54495727 TGGCCAGGCAAGATTGGCTCAGG - Intergenic
1008972799 6:57389249-57389271 TAGCCAGGCACTGTTGGCACAGG - Intronic
1009161706 6:60290804-60290826 TAGCCAGGCACTGTTGGCACAGG - Intergenic
1012947720 6:105485715-105485737 TACCCAGGAGTGGTAGTCTCCGG - Intergenic
1015442517 6:133264789-133264811 TGTCCAGGCATGCTTTGCTCTGG - Intronic
1016757839 6:147706369-147706391 TAGCCAGGCATGGTTGGTGGCGG - Intronic
1020228767 7:6300943-6300965 TACCCAGGCATGGTGGCATATGG + Intergenic
1021123829 7:16826930-16826952 TAGCCAGGCAGTGTTCGCTCTGG + Intronic
1027837552 7:83264479-83264501 TACGCAGGCATGGTTTGAACAGG - Intergenic
1028048105 7:86149347-86149369 TACCCAAGCATGCTTTCCTCAGG - Intergenic
1031992442 7:128207080-128207102 GACCCAGGCCAGGTTGGCTCAGG + Intergenic
1035051298 7:156000438-156000460 CATCCAGGCATGGATGGGTCTGG - Intergenic
1036742163 8:11372848-11372870 CACCCAGTCATGGTTGCCTCTGG - Intergenic
1037624545 8:20595590-20595612 TACCCAGGGATGTTTGGGTGGGG + Intergenic
1037743111 8:21622850-21622872 GACCCAGGGCTGGTGGGCTCTGG - Intergenic
1041054414 8:53968694-53968716 TAGCCAGGCATGGTGGTCCCAGG + Intronic
1041322963 8:56633723-56633745 TAGCCAGGCATGGCTGGGTGTGG - Intergenic
1041828968 8:62130849-62130871 TAGCCAGGCATGGGAGGCTAAGG + Intergenic
1044695731 8:94920664-94920686 TGCCCAGGCATGGGTGCTTCAGG + Intronic
1044937802 8:97309794-97309816 TTCTCAGGCATGTTTGGCTCAGG - Intergenic
1047644742 8:126858221-126858243 TAGGCAGCCATAGTTGGCTCTGG + Intergenic
1048099831 8:131338927-131338949 ATCCCAGGCATGGTTGGTTAGGG + Intergenic
1050725082 9:8640074-8640096 TACCCAGGCATGGTGGTGTGTGG - Intronic
1051671662 9:19516540-19516562 GACTCGGGCATGGTTGGCCCAGG + Intronic
1052729065 9:32264310-32264332 TTCCAGGGCATGGTTTGCTCTGG - Intergenic
1056746972 9:89311412-89311434 GACCCAGGCATAGTAGGGTCGGG + Intronic
1058733957 9:107877157-107877179 TAGCCAGGCAGTGGTGGCTCAGG + Intergenic
1060151042 9:121288449-121288471 TGCCCAGGTACGGTTGGCACAGG + Intronic
1060503472 9:124180702-124180724 TCCCCAGGGCTGGCTGGCTCTGG + Intergenic
1060683064 9:125582892-125582914 CACCCAGGAATGATTGGCTGAGG + Intronic
1061553974 9:131354930-131354952 TACCCAGGCATGGTGGTGTGCGG - Intergenic
1062458999 9:136655073-136655095 TGCCCAGGCAGGGGTGGCTCAGG + Intergenic
1062576942 9:137213326-137213348 TTCCGAGGCATGACTGGCTCTGG - Intronic
1186724146 X:12338866-12338888 AACACAGGCAAGGTGGGCTCTGG - Intronic
1187216490 X:17282150-17282172 TGCACAGGCAAGGTGGGCTCTGG - Intergenic
1190126375 X:47709096-47709118 TAAACAGGCAGGATTGGCTCTGG + Intergenic
1190336031 X:49262247-49262269 TACCCAGCCATGGGTGTCCCTGG - Intronic