ID: 1164737972

View in Genome Browser
Species Human (GRCh38)
Location 19:30555908-30555930
Sequence AGCCAATTGCCTTCTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164737972_1164737979 -1 Left 1164737972 19:30555908-30555930 CCAGCACAAGAAGGCAATTGGCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1164737979 19:30555930-30555952 TTGAGGGTGTGGGAGACCTGGGG 0: 1
1: 0
2: 2
3: 30
4: 303
1164737972_1164737977 -3 Left 1164737972 19:30555908-30555930 CCAGCACAAGAAGGCAATTGGCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1164737977 19:30555928-30555950 GCTTGAGGGTGTGGGAGACCTGG 0: 1
1: 0
2: 0
3: 14
4: 244
1164737972_1164737978 -2 Left 1164737972 19:30555908-30555930 CCAGCACAAGAAGGCAATTGGCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1164737978 19:30555929-30555951 CTTGAGGGTGTGGGAGACCTGGG 0: 1
1: 0
2: 1
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164737972 Original CRISPR AGCCAATTGCCTTCTTGTGC TGG (reversed) Intronic
900672954 1:3867192-3867214 AGCCAATTTCCTTCTTTTTAAGG + Intronic
902276695 1:15345178-15345200 AGCCACATACCTTCTTCTGCTGG - Exonic
904856005 1:33498791-33498813 AGCCAATGCCCTTCTTGAGGTGG - Intergenic
909366646 1:74831526-74831548 AGCCAATTGCATTCACATGCAGG - Intergenic
911987474 1:104646252-104646274 AGCCAGTTGTCATCTTTTGCTGG - Intergenic
912572451 1:110634479-110634501 AGCCTGTTGCCTTCCTGTACTGG + Intergenic
913340312 1:117752005-117752027 AGACAAGTGCCCTCTTGGGCAGG + Intergenic
915757152 1:158273276-158273298 TTCCAATTTCCTTCTTTTGCGGG - Intergenic
916624265 1:166536899-166536921 AGGCAATTGTTGTCTTGTGCTGG - Intergenic
921506831 1:215982085-215982107 AGCCAATTGTCTTCTTTTTCAGG + Intronic
921991899 1:221375746-221375768 AGCCATCTACCTTCTTCTGCAGG - Intergenic
922842486 1:228654507-228654529 AGCCAATCAACTTCTTGTTCTGG - Intergenic
1065810225 10:29436159-29436181 AGCCACTTGCCCTCTAGGGCGGG + Intergenic
1065863953 10:29897362-29897384 AGTCAAATGCCTTTTTGTTCAGG + Intergenic
1072102386 10:92240901-92240923 AGCAAACTGCCTTCTTGCGTTGG + Intronic
1073277801 10:102327713-102327735 AGCCACATGCCTTCTTGTGACGG - Intronic
1076093678 10:127712920-127712942 TGCCCATTGCCATCCTGTGCAGG + Intergenic
1076491787 10:130866694-130866716 AGCCAGATACCTGCTTGTGCAGG - Intergenic
1086191796 11:84088318-84088340 AGCCAATTACATTCTTATGCAGG + Intronic
1089075242 11:115733420-115733442 ACCCAATTTCCTTCTAGTGGCGG - Intergenic
1092432465 12:8420444-8420466 AGCTTATTGGCTTCTTGTACTGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1097625564 12:61995983-61996005 AGCCAATTGTCTTTTTGTGGGGG - Intronic
1102949716 12:117022968-117022990 AGCCATCTGTCTTCTTGTTCTGG + Intronic
1103270855 12:119672452-119672474 AGGCAATTACCTTCTGGTGAGGG - Exonic
1106562140 13:30856142-30856164 TGCCCAGTGCCTTCTTGTGCTGG + Intergenic
1106569631 13:30915425-30915447 GTCTCATTGCCTTCTTGTGCTGG - Intronic
1108574167 13:51777218-51777240 GGCCACTTGCCCTCTTGTGGGGG - Intronic
1108580150 13:51821107-51821129 TGCCAGCTGCCTTCTGGTGCGGG - Intergenic
1113799218 13:113077892-113077914 AGGCTCTTGCCTTCCTGTGCTGG + Intronic
1116608386 14:47032900-47032922 ATCCAGTTGCCTTCCTGGGCAGG + Intronic
1118182117 14:63504281-63504303 GGCCAATTGACTTCTTGGGTGGG - Intronic
1119429929 14:74559986-74560008 AGCAAGTTCCATTCTTGTGCTGG - Intronic
1119873320 14:78035315-78035337 GGCCAATTTACTTCCTGTGCTGG + Intergenic
1120024804 14:79570786-79570808 AGCCAATTGGCTTTCTGTGAGGG + Intronic
1125100870 15:35911213-35911235 AACCAATTAGCTTCTTGTGCTGG - Intergenic
1126385968 15:48093736-48093758 ATCCAGTTGCCTTCTTCTGGAGG + Intergenic
1131076666 15:89499511-89499533 GGCAAACGGCCTTCTTGTGCTGG - Intergenic
1135203589 16:20462340-20462362 AACCAACTCCCTTCTTGTTCAGG - Intronic
1137057229 16:35751539-35751561 AGCCCAGTGCCTCCTTGTGGGGG + Intergenic
1142017106 16:87755413-87755435 AGCCCATGGCCTCCCTGTGCTGG - Intronic
1150284711 17:63948287-63948309 AGCAAATTGCCATCATCTGCTGG + Intronic
1153932267 18:9888604-9888626 AGCTAACCTCCTTCTTGTGCCGG + Intronic
1154000388 18:10477654-10477676 GGCCAATTTCCTGCTTTTGCAGG - Intronic
1156818010 18:41335301-41335323 ACACAATTGCCTTAGTGTGCTGG - Intergenic
1158455868 18:57607136-57607158 AGCCAGGTGCCTTCGTGTTCTGG + Exonic
1158661804 18:59395415-59395437 AGCCACCTACCTTCTTGTGGGGG - Intergenic
1158665424 18:59428498-59428520 AGAAAATTTCCTTCTTGTACTGG + Intergenic
1159777474 18:72620185-72620207 AGCCCTTTGCCTTCTTGCACAGG + Intronic
1164737972 19:30555908-30555930 AGCCAATTGCCTTCTTGTGCTGG - Intronic
1165115355 19:33524985-33525007 ACCCAAATGCCATCTTGTGTAGG - Intergenic
925931895 2:8714701-8714723 AGCGGATTGCCTTCCTTTGCAGG - Intergenic
926966114 2:18413544-18413566 AGCTAATTGACTTCTTGGGCTGG - Intergenic
927153461 2:20208789-20208811 AGCCTGTTGCCTTCCTGGGCAGG - Intronic
929569656 2:43013992-43014014 AGCCCATTTCCTGCTGGTGCAGG - Intergenic
929778467 2:44942843-44942865 AACCAGTTGCCTACTTGTGTGGG - Exonic
932016389 2:68032142-68032164 AGCCAATTGTCTCCTGGTGTGGG + Intergenic
933191452 2:79338412-79338434 AACCAATGGGCTTCTAGTGCAGG + Intronic
935069814 2:99684203-99684225 AGCCATCTGCCTCCTTGTTCAGG + Intronic
938927178 2:136054832-136054854 CTTCAAATGCCTTCTTGTGCTGG - Intergenic
939344200 2:140941706-140941728 AGTCAATTGGCTTCATTTGCAGG - Intronic
939558077 2:143701193-143701215 AGCCAAATACCATCTTCTGCAGG + Intronic
939808672 2:146806055-146806077 AGCCAACTGCATTCTTTTTCTGG + Intergenic
941855113 2:170223053-170223075 ACCAAATTGCCTTCCTGTGTGGG + Intronic
943846590 2:192656544-192656566 AGCCCACTGCCTTCTTTTCCTGG - Intergenic
944926955 2:204475139-204475161 AGCCACTTGCCTCCTTCTGCAGG + Intergenic
947400016 2:229722354-229722376 ACCCCATTTCCTTCTTGTTCAGG - Intergenic
1169045792 20:2533537-2533559 CCCCAAGTGCCTTCTTGTGAAGG - Intergenic
1170487005 20:16828649-16828671 TGCCATGTGCCTCCTTGTGCAGG - Intergenic
1174730686 20:52914163-52914185 GGCGAATTGACTTCTTGTGATGG - Intergenic
1177233112 21:18348438-18348460 AGCCTATTTCCTTCTTGAGAGGG - Intronic
1179193533 21:39143649-39143671 AGCAAATTGCCTTCAGGGGCTGG - Intergenic
1182486825 22:30644082-30644104 ACCCAACCGCCTTCTTGTGATGG + Intronic
953426852 3:42802689-42802711 AGCCAATAGCCTTATTTTACAGG + Intronic
954120309 3:48494590-48494612 AGCCAATTTCCTTCTTTTTAAGG + Intronic
969474828 4:7415889-7415911 GCCCAATTGCCCTCTTCTGCAGG - Intronic
970895606 4:21100011-21100033 AGAAAATTGCCTTCTTGAGATGG + Intronic
973563269 4:52158167-52158189 AGCAAATTGCATTGTTTTGCTGG - Intergenic
974088671 4:57287902-57287924 AGCCAATTGCTTTCTTTTCCTGG - Intergenic
976492005 4:85681818-85681840 AACCAAATGCTTTCTTGTGAAGG + Intronic
977145947 4:93440030-93440052 AGGAAATGGCCTCCTTGTGCAGG + Intronic
980330715 4:131408165-131408187 AGGCATTTGCCTTCTAGTTCTGG + Intergenic
980531414 4:134060591-134060613 AGCAAGTTCCCTTCTGGTGCAGG - Intergenic
980819789 4:137999239-137999261 AGACAATTGCCTTGTTTTTCTGG - Intergenic
981563999 4:146078791-146078813 TGTCCATTGCCTTCTTATGCAGG - Intergenic
987176587 5:15317364-15317386 AGCCAATTGTCTTGTTGGGAAGG - Intergenic
988712188 5:33789556-33789578 AGCCATTTTCCTCCTTGGGCAGG - Intronic
990678286 5:58213192-58213214 TGTCAATGGCTTTCTTGTGCAGG + Intergenic
990999651 5:61769911-61769933 AGCCAATATCTTTCTTTTGCAGG + Intergenic
994001194 5:94781773-94781795 AGCCAATTACCCACTTGTGCAGG - Intronic
998772789 5:145565239-145565261 AGCCACCTGCCTTCCTTTGCTGG - Intronic
1000375006 5:160572273-160572295 AGCTAATTGCTTTCTTCTTCAGG - Intronic
1002993341 6:2258253-2258275 AGTCAATTGACCTTTTGTGCAGG + Intergenic
1009436300 6:63622123-63622145 AGCCAATTAACATCTTTTGCAGG - Intergenic
1010792189 6:80077464-80077486 ATCCACTTGCTTTCTTGTGAAGG + Intergenic
1011291196 6:85779161-85779183 AGTGAGTTCCCTTCTTGTGCAGG + Intergenic
1011790849 6:90896609-90896631 AGCCAGTTGCCATCCAGTGCAGG - Intergenic
1012554228 6:100492136-100492158 AGACAAATGCCTTCCTGTGGCGG - Intergenic
1014865283 6:126521515-126521537 AGCAGATTCCCTTCTGGTGCAGG + Intergenic
1018844808 6:167548254-167548276 AGCCAAGTGCTTTCCTGGGCAGG - Intergenic
1020071343 7:5228887-5228909 AGCTAATTACTTTCTTGTGCAGG + Intronic
1022057455 7:26753679-26753701 AGCCAGTTGCCTGCATGTGTTGG + Intronic
1027056562 7:75053496-75053518 GACCAAGTGCCTGCTTGTGCTGG + Intronic
1030186484 7:106767110-106767132 ACCCAATTTCCTTCATGTGCTGG - Intergenic
1035327795 7:158076097-158076119 AGAAAATTGCCTCCATGTGCAGG - Intronic
1035659555 8:1336534-1336556 AGCCAAAGTCCTTCCTGTGCTGG - Intergenic
1037589207 8:20299150-20299172 AGCCTGTTGCCTCCTTATGCTGG - Intronic
1037650984 8:20838360-20838382 AGCCTATTGCCTGCTGGGGCAGG - Intergenic
1038773555 8:30506913-30506935 AACCAATTTCCTTCTTCTCCAGG - Intronic
1041685571 8:60641774-60641796 AGTCAAAGGCCTTCTTGTGTGGG - Intergenic
1047692333 8:127368537-127368559 ATCAAATTGCCTTATTGTTCTGG + Intergenic
1048986955 8:139739849-139739871 TGCCATTTGCCTGCCTGTGCTGG - Intronic
1051673038 9:19531452-19531474 AGCAAATTGCATCCATGTGCTGG + Intronic
1051776924 9:20644503-20644525 AGTCAATTATCTTTTTGTGCAGG + Intergenic
1052569709 9:30203877-30203899 AGACATTTGCCATGTTGTGCAGG + Intergenic
1053491242 9:38505302-38505324 AGCCCATGGGCTTCTTCTGCTGG + Intergenic
1057671549 9:97094503-97094525 AGCCCATGGGCTTCTTCTGCTGG + Intergenic
1059255788 9:112929439-112929461 AGCCCATTGCAGTCCTGTGCTGG - Intergenic
1059393977 9:114018948-114018970 TGCCAATGGACTTCTTGTGGAGG + Intronic
1059914004 9:119078168-119078190 AGTCAAATGCCTTCTTCTCCTGG - Intergenic
1059946371 9:119412551-119412573 AGCCAAAAGCCTGCTTGTGAGGG - Intergenic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1062142744 9:134968795-134968817 AGCAACTTGCCTTCTGGTGCTGG - Intergenic
1185525907 X:778541-778563 AGCCCATCACCTTCTTCTGCAGG + Intergenic
1186187969 X:7040379-7040401 AGCCAAGTGCCTGCTACTGCAGG + Intergenic
1186545425 X:10444284-10444306 AGCCATGTGCCTTCTTGTCTAGG - Intergenic
1188513688 X:30962865-30962887 AGCCATTTGCCTTCACATGCAGG - Intronic
1188997657 X:36905201-36905223 TCCCAACTGCCTTCTTGGGCTGG - Intergenic
1189770306 X:44418622-44418644 AAATAATTGCCTTCTAGTGCTGG + Intergenic
1193394826 X:80970981-80971003 AAAAAATTGCCTCCTTGTGCTGG - Intergenic
1197019329 X:121667913-121667935 AGCTAATTGCCTTCATATGAAGG - Intergenic
1199471257 X:148198660-148198682 AGCCAAATTCCTTGTTGTGGGGG + Intergenic
1200060337 X:153481119-153481141 AGCCAAGTGCCCTCGTGTGTGGG + Intronic
1201526422 Y:14940197-14940219 AGGCAATTACATTCATGTGCAGG - Intergenic