ID: 1164743578

View in Genome Browser
Species Human (GRCh38)
Location 19:30594731-30594753
Sequence CAGGGGAAACAGGAGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 946
Summary {0: 1, 1: 0, 2: 11, 3: 103, 4: 831}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164743578_1164743586 25 Left 1164743578 19:30594731-30594753 CCACTCTTCTCCTGTTTCCCCTG 0: 1
1: 0
2: 11
3: 103
4: 831
Right 1164743586 19:30594779-30594801 ATTCCATTTAGTGACAGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1164743578_1164743582 -5 Left 1164743578 19:30594731-30594753 CCACTCTTCTCCTGTTTCCCCTG 0: 1
1: 0
2: 11
3: 103
4: 831
Right 1164743582 19:30594749-30594771 CCCTGCGAGAAGCCGCTGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164743578 Original CRISPR CAGGGGAAACAGGAGAAGAG TGG (reversed) Intronic
900469064 1:2842808-2842830 AAGGGAAAACAGGAAAAAAGTGG - Intergenic
900627377 1:3615053-3615075 CAGGGGAAAGATGAGAGTAGTGG - Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
901138317 1:7011926-7011948 CAGGGGAAATTGGAGGAGTGGGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
901755976 1:11441841-11441863 GAGAGGAGACAGGAGGAGAGAGG + Intergenic
902236914 1:15063510-15063532 CAGGTGACACAGGAGAGCAGAGG - Intronic
902620824 1:17649896-17649918 CAGGCGAGGCAGGAGGAGAGAGG + Intronic
903003580 1:20283730-20283752 GAGGGGAAGCAGGACACGAGAGG + Intergenic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
903139804 1:21332666-21332688 CGGAGGAGACAGGAGGAGAGGGG + Intronic
903366788 1:22810316-22810338 CACAGGAAACAGGAGAACAGTGG - Intronic
903834127 1:26191647-26191669 CAGGAGGGACAGGAGAAGAATGG + Intronic
904322720 1:29707568-29707590 GAGGGGAGGCAGGAGAGGAGAGG + Intergenic
904395701 1:30220050-30220072 GAGGAGACCCAGGAGAAGAGGGG + Intergenic
904416252 1:30362760-30362782 CAGGGGAAACAGGAGTGTGGAGG - Intergenic
904422914 1:30405574-30405596 AATGGGTTACAGGAGAAGAGAGG - Intergenic
904424239 1:30413335-30413357 CAGGAGAAGCTGGCGAAGAGGGG + Intergenic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904467213 1:30715314-30715336 CAGGAGGAACAGGAGAAGTAAGG + Intronic
904468388 1:30721265-30721287 CTGGGGAAACAGGGTCAGAGAGG - Intronic
904705494 1:32387216-32387238 AAGAGCAAACAGGAAAAGAGGGG + Intronic
904721039 1:32508764-32508786 CAGGGGAAAGAGAGAAAGAGAGG - Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905549688 1:38826706-38826728 CAGATGCAACAGGAGAAGTGAGG + Intergenic
905720130 1:40191876-40191898 ATGGGGAGACAGGTGAAGAGAGG + Intronic
905737853 1:40342874-40342896 TAGGGGAAACTGGAGGAAAGAGG - Intergenic
906017392 1:42593929-42593951 CAGGGGAAAGCTTAGAAGAGTGG + Intronic
906273235 1:44497803-44497825 GAGGGGAGACACGAGAAAAGGGG - Intronic
906562482 1:46769273-46769295 AGTGGAAAACAGGAGAAGAGTGG - Intronic
906794614 1:48687214-48687236 CAAGGGAAAGAGAAGAGGAGGGG + Intronic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
907154885 1:52324503-52324525 CAGAGGAAACAGCATAAGTGAGG - Intronic
907267785 1:53273174-53273196 CTGGGGAGCCAGGAGAGGAGGGG + Intronic
907303523 1:53502176-53502198 CAGGGGAGAGAGGAGAAGAGAGG + Intergenic
907718350 1:56948733-56948755 CAGGAGAAACAGGAGAGCAATGG + Intronic
907888926 1:58619768-58619790 AAGTGGAGACAGGAGAAGAAGGG + Intergenic
907969551 1:59367615-59367637 GAGGGGCAACATGAGAAGATAGG - Intronic
908030210 1:59991043-59991065 CAGGGGAAAGAGAACAAGATGGG + Intronic
909464314 1:75956281-75956303 TATTGGAAACTGGAGAAGAGGGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909809823 1:79918771-79918793 CAGTGGAAGCAGGAGATGTGTGG + Intergenic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910303624 1:85736349-85736371 CAGAGGAAATAGGAGCAGTGGGG - Intronic
911054888 1:93701076-93701098 GTGGGGAAACAGGAGCAGAGAGG - Intronic
911266586 1:95751762-95751784 CATGGGAAACAGAAGATGATAGG - Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911939409 1:104022431-104022453 AAGAGTAAACAGGACAAGAGAGG - Intergenic
913169850 1:116222050-116222072 GAGGGGAAAAAAGAGAGGAGGGG + Intergenic
913372622 1:118117563-118117585 ATGGGGAGACAGGAGATGAGGGG + Intronic
914901786 1:151715052-151715074 TAGGGAAAATGGGAGAAGAGAGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915839624 1:159203825-159203847 CTGGGGAAACAGCTGAGGAGGGG + Intronic
915864317 1:159482226-159482248 GAGGAGGAACAGGAGAAGATGGG + Intergenic
916239927 1:162629248-162629270 GAGAGGAAAGAAGAGAAGAGAGG + Intergenic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917635370 1:176930579-176930601 CTGGGGCATCAAGAGAAGAGAGG + Intronic
917930177 1:179817463-179817485 CAGGGGCAGCAAGGGAAGAGAGG + Intergenic
918140977 1:181719698-181719720 GAGGAGGAAGAGGAGAAGAGGGG - Intronic
919172379 1:193971556-193971578 GAGGGGAAAGCAGAGAAGAGTGG - Intergenic
919244318 1:194959546-194959568 GAGTAGAAACAGCAGAAGAGAGG - Intergenic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
920118235 1:203636405-203636427 CAGGGTTTCCAGGAGAAGAGAGG - Intronic
920182621 1:204141834-204141856 CAAGGGCAACAGGAGCAGTGGGG + Intronic
920299634 1:204980651-204980673 GAGAGGAGACAGGAGCAGAGGGG + Intronic
920364309 1:205440087-205440109 CAGGGGAGACAGGAGAATCAAGG + Intronic
920428789 1:205900464-205900486 GAGGGGAAACCGGAACAGAGAGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
921450818 1:215303449-215303471 CAGGGGAAAAGGGTGAAGAATGG - Intergenic
921650933 1:217677108-217677130 CAAGAGAAACAGTAGAACAGAGG + Intronic
922020452 1:221699196-221699218 TACGGGAAACAGGAGAAAATGGG - Intergenic
922891428 1:229064854-229064876 CAAGGGAAGCAAGAGCAGAGGGG + Intergenic
923546767 1:234928980-234929002 TAGGGGAAGCAGGATAAAAGGGG + Intergenic
923782087 1:237033784-237033806 CAGGTGGCACAGGAGAAAAGAGG - Intergenic
924291427 1:242540612-242540634 CAGGGGAATCAGTAAAAGAGAGG + Intergenic
1062954333 10:1530166-1530188 CAGGGGCAACAGGTGAGCAGAGG - Intronic
1063418938 10:5895780-5895802 TAAGGGGAAGAGGAGAAGAGTGG + Intronic
1063614812 10:7592509-7592531 TAGGGGAAAGAGGAAAATAGAGG + Intronic
1063662268 10:8043107-8043129 GACGGGAAACAGGCGGAGAGAGG + Intergenic
1064947575 10:20807909-20807931 CAGAAGATACAGGAAAAGAGTGG + Intronic
1065259773 10:23912478-23912500 AAGGGGAAAAAGTAGGAGAGGGG - Intronic
1065626604 10:27635617-27635639 AAGGTGAAGCAGGAGAAGACAGG - Intergenic
1066030224 10:31413953-31413975 CAGGGCTGACAGGAAAAGAGGGG - Intronic
1066179287 10:32944073-32944095 CAGGGGAAAAAGCAAAAGAGAGG + Intronic
1066200735 10:33140895-33140917 CAGAGGGAAGAAGAGAAGAGTGG - Intergenic
1066224680 10:33370600-33370622 CAGAGGAAACAAGAGAGGGGAGG - Intergenic
1067043831 10:42973526-42973548 ACAGGGACACAGGAGAAGAGAGG - Intergenic
1067165917 10:43866516-43866538 CAGGGGAACCAGGAGAGAATGGG - Intergenic
1067307619 10:45079649-45079671 CAGGGGAAACAGCTTAAGATTGG + Intergenic
1067523049 10:47022410-47022432 GAGGGAGAGCAGGAGAAGAGGGG + Intergenic
1067794339 10:49309907-49309929 AAGGGGAAACAGGAAGACAGTGG - Intronic
1068496440 10:57789985-57790007 CAGGGTAAAGAGGAAAACAGTGG - Intergenic
1068569052 10:58608206-58608228 CAGTGGAAGCAGGAGAGGTGGGG - Intronic
1069095589 10:64255648-64255670 GAAGGGAAAATGGAGAAGAGAGG - Intergenic
1069226050 10:65945667-65945689 CTGGGGAATGAGGAGAAAAGAGG + Intronic
1069319584 10:67151928-67151950 AGGGGGAAACTGGAGAAGAAAGG - Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070091585 10:73291196-73291218 CAGGGAATAGAGGTGAAGAGTGG - Intronic
1070248897 10:74756379-74756401 CAGGGTAAAGAGGGGAGGAGAGG + Intergenic
1071351978 10:84755647-84755669 CAGGGAAAATAGGAAAGGAGAGG + Intergenic
1071499136 10:86191264-86191286 CAGGGGAACAAGGAGAAGAGAGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072539265 10:96385807-96385829 AAGGAGAATCAGGACAAGAGTGG - Intronic
1072610922 10:97017265-97017287 CAAGGCAACCAGGGGAAGAGAGG + Intronic
1072777481 10:98213520-98213542 CAGGGGAAAAAGAACAAAAGGGG + Intronic
1073091124 10:100940755-100940777 CAGGGGAAGGGGGAGAAGTGGGG - Intronic
1073599620 10:104834083-104834105 CTGGGGAGACAGGTGAAGAGGGG - Intronic
1073629232 10:105131769-105131791 GAGGAGAAGCAAGAGAAGAGAGG + Intronic
1074214624 10:111372415-111372437 AAGAGGAAACAGGAAAAGATTGG + Intergenic
1074384090 10:113003512-113003534 GCTGGGAAACAGGATAAGAGAGG - Intronic
1074414918 10:113259629-113259651 CAGGTGAACCAGGAGAAGATGGG - Intergenic
1074473423 10:113747761-113747783 TGGAAGAAACAGGAGAAGAGTGG + Intergenic
1074541012 10:114365162-114365184 CAGGGGAAGTAGGAGAGGAGAGG - Intronic
1074765776 10:116699021-116699043 CAGGGGCAACAGTAGAAGTCAGG + Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075744769 10:124719238-124719260 GTGGGGGAACAGGAGAAGAAAGG + Intronic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076031905 10:127166412-127166434 CAGGGGAGAGAGAAGATGAGTGG + Intronic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076291224 10:129347427-129347449 CAAGGGAAAGGGGAGAGGAGAGG + Intergenic
1076481653 10:130788969-130788991 CAGGGGAAGCAGGGGAGCAGGGG + Intergenic
1076481662 10:130788994-130789016 CAGGGGAAGCAGGGGAGCAGGGG + Intergenic
1076617322 10:131764291-131764313 CAGGGGCAGCAAGAGAAGTGAGG - Intergenic
1076752301 10:132549638-132549660 CAGGTGAAGCAGGAGCAGACAGG + Intronic
1076815432 10:132912321-132912343 CAGGAGAGAGAGAAGAAGAGAGG - Intronic
1077334595 11:1997785-1997807 CGGGGGAAACTGGGGAAGTGGGG - Intergenic
1077644584 11:3912166-3912188 GAGGGGAGAAAGGAGGAGAGGGG - Intronic
1077662494 11:4082374-4082396 AAGGGCAAAAAGGAGAAAAGAGG - Intronic
1077925220 11:6675075-6675097 AGGAGGAAACAGGAGAAGGGAGG + Intergenic
1078267656 11:9766885-9766907 GAGGGGATAAAGGAGGAGAGGGG - Intergenic
1078831113 11:14978019-14978041 CAGAAGAGACAGGAGAAGAAGGG + Intronic
1079309002 11:19347950-19347972 CAGGAGAAAGAGGAGAAGCAAGG - Intergenic
1079583509 11:22096074-22096096 GAGGGGAAAGAGTAGAAGATGGG + Intergenic
1080329847 11:31123679-31123701 AAGGAGAAACCTGAGAAGAGAGG + Intronic
1080774753 11:35375368-35375390 CAGAGGAACAAGGGGAAGAGAGG + Intronic
1080776724 11:35393533-35393555 CAGTGGAAAGAAGTGAAGAGGGG - Intronic
1081375690 11:42355427-42355449 CAGGGGAAGAAAGAGAACAGAGG + Intergenic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1081979055 11:47254864-47254886 CACAGGAAACAGGGAAAGAGTGG - Intronic
1081999146 11:47383435-47383457 AAGGGGAGGGAGGAGAAGAGAGG + Intergenic
1082031332 11:47606341-47606363 AAGAGGAAAAAGGAGAAGACAGG - Intergenic
1082163150 11:48906527-48906549 CAGAGGAAGCAGGAGAGAAGTGG + Intergenic
1082169665 11:48988110-48988132 CAGAGGAAGCAGGAGAGAAGTGG - Intergenic
1082173623 11:49035736-49035758 CAGAGGAAGCAGGAGAGAAGAGG + Intronic
1082204591 11:49417634-49417656 GAGGGGGAAGAAGAGAAGAGAGG - Intergenic
1082234551 11:49807959-49807981 CAGAGGAAGCAGGAGAGAAGTGG + Intergenic
1082238251 11:49846204-49846226 CAGAGGAAGCAGGAGAGAAGTGG - Intergenic
1082608251 11:55268663-55268685 CAGAGGAAGCAGGAGAGAAGTGG + Intronic
1082611540 11:55304715-55304737 CAGAGGAAGCAGGAGAGAAGTGG - Intergenic
1082658372 11:55878972-55878994 CAGAGGAAGCAGGAGAGAAGTGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083849625 11:65357250-65357272 CATGGGAAACAAGAGAGGAAGGG - Exonic
1083866910 11:65460196-65460218 GAGGGGAAAGAGGGGAAGACGGG - Intergenic
1083880208 11:65544663-65544685 TAGGGGACTCAGGAGAACAGTGG - Intronic
1083990439 11:66243141-66243163 TAGGGGTGACAGGAGAGGAGGGG - Intronic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084567978 11:69942407-69942429 CAGGGAAAACCGGCGAAGGGGGG + Intergenic
1084693326 11:70739439-70739461 CAGGGGCAAGAGGAGAGGACGGG - Intronic
1084697308 11:70763337-70763359 CAGGGGACACAGGGGCACAGAGG + Intronic
1084762325 11:71281852-71281874 CAGTGGAAACAGGCCAAGAGAGG - Intergenic
1085400423 11:76232606-76232628 CAGGGGAACTTGGAGCAGAGGGG - Intergenic
1085552229 11:77384733-77384755 CAGGGGAGAAGGGAGAAGTGAGG + Intronic
1086650501 11:89282882-89282904 GAGGGGGAAGAAGAGAAGAGAGG + Intronic
1086692144 11:89800363-89800385 CAGAGGAAGCAGGAGAGAAGAGG - Intronic
1086696169 11:89848530-89848552 CAGAGGAAGCAGGAGAGAAGTGG + Intergenic
1086702355 11:89913858-89913880 CAGAGGAAGCAGGAGAGAAGTGG - Intronic
1086703812 11:89930592-89930614 CAGAGGAAGCAGGAGAGAAGTGG + Intergenic
1086709987 11:89995959-89995981 CAGAGGAAGCAGGAGAGAAGTGG - Intergenic
1086713655 11:90039297-90039319 CAGAGGAAGCAGGAGAGAAGAGG + Intronic
1087174380 11:95082642-95082664 CAGGGGAGGGAGGAGAGGAGGGG - Intergenic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1088424731 11:109691091-109691113 GAGGGGAACAAGCAGAAGAGGGG - Intergenic
1088735169 11:112722895-112722917 CAGGGGAAGAGAGAGAAGAGTGG + Intergenic
1088881385 11:113975988-113976010 CAAGGGAGTCAGGAGAAGATGGG - Intronic
1089281721 11:117379413-117379435 CAGGGTCAACAGGAGAGGTGGGG - Intronic
1089927713 11:122276218-122276240 AAGGGGGGAGAGGAGAAGAGGGG + Intergenic
1089995722 11:122905292-122905314 CCAGGGATACAGGACAAGAGTGG + Intronic
1090023683 11:123149714-123149736 GTGGGGAAATGGGAGAAGAGAGG + Intronic
1090081241 11:123614216-123614238 CAGGGGAGGCAGAAGAAGAGGGG + Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1091205387 11:133817588-133817610 CAGGGGAGTAAGGAGAACAGGGG - Intergenic
1202817578 11_KI270721v1_random:52967-52989 CGGGGGAAACTGGGGAAGTGGGG - Intergenic
1091484307 12:869015-869037 TGGGGGAAACAGAAGAAAAGTGG - Intronic
1091710585 12:2737439-2737461 CAGGGGAGAAAGGAGAAGTGTGG - Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092290826 12:7158621-7158643 GAAGGGAAACAGGACAAGAAAGG - Exonic
1092786250 12:12029649-12029671 CAGGGGAATCAGGATATGAGTGG - Intergenic
1093118918 12:15244739-15244761 AAGGAGAAAAAGGTGAAGAGGGG + Intronic
1093360579 12:18221808-18221830 AAGGGGAAACAGGAAATCAGGGG + Intronic
1093463108 12:19424190-19424212 CAGAGAAATCAAGAGAAGAGTGG + Intronic
1093534839 12:20210336-20210358 CAGAGAGGACAGGAGAAGAGAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094746682 12:33352673-33352695 CAGAGGACACAGTAGAGGAGAGG + Intergenic
1095797976 12:46241360-46241382 CTGTGGAAAGAGGAAAAGAGGGG - Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096617098 12:52839489-52839511 TAGGGGGAAAAGGACAAGAGGGG + Intronic
1096843115 12:54391048-54391070 CCTGGGAAAGAGGGGAAGAGGGG + Intronic
1097023699 12:56038224-56038246 GAGGGGAATCAGAAGAAGAGAGG - Exonic
1097282643 12:57854200-57854222 CAGGGAAAACAGAGGAGGAGGGG + Intergenic
1097638831 12:62154301-62154323 TGGGGGAAGCAGGAGAATAGGGG + Intronic
1097956544 12:65492526-65492548 GAGGGGCAACAGAAGAAAAGGGG - Intergenic
1098478353 12:70932910-70932932 CAGAGGAAACACAAAAAGAGAGG - Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1100468127 12:94866581-94866603 AAGGGTAAGCAGGAGAACAGTGG + Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101870727 12:108563115-108563137 CTGGGGAAACAGGTTCAGAGAGG - Intronic
1102512470 12:113425103-113425125 AAGGGGAAACAGGCACAGAGAGG + Intronic
1102549405 12:113680462-113680484 CCAGGGATACAGGAGAAGAGAGG - Intergenic
1102616777 12:114161549-114161571 AAGGGGCAACTGGGGAAGAGTGG + Intergenic
1102734110 12:115142757-115142779 CAGGAGAAGCAGGGGAAGAGAGG - Intergenic
1102947733 12:117004778-117004800 CTGGGGAAACAGGAGAGCTGGGG - Intronic
1103020265 12:117528413-117528435 CTGGGGAAATAGGAAAGGAGGGG - Intronic
1103739411 12:123081338-123081360 TAGGGGAAACAGCAGTTGAGGGG - Intronic
1105917922 13:24934106-24934128 CAGAGGGAACAGGAGAGGACAGG - Intergenic
1106519565 13:30484758-30484780 AAGAGGAAAGAGGAGAGGAGAGG + Intronic
1106674890 13:31948015-31948037 TAGGGGCAGCAGCAGAAGAGGGG + Intergenic
1106758988 13:32849422-32849444 AAGCGGGACCAGGAGAAGAGTGG + Intergenic
1107422567 13:40262217-40262239 CAAGAGAAAAAGGAGAAAAGGGG + Intergenic
1108814548 13:54273898-54273920 AAGGGGAAAGAGGAGAAGAAAGG - Intergenic
1109206543 13:59489082-59489104 AAGGGGAATGAGGAGAAGAGAGG - Intergenic
1109618270 13:64865482-64865504 CAGAGTAAACATGAGAGGAGAGG - Intergenic
1110050284 13:70888147-70888169 ACTGGGAAACAGTAGAAGAGTGG - Intergenic
1110785290 13:79517310-79517332 GAGGGGAGACAGGAGAGGAGGGG - Intronic
1110843649 13:80170216-80170238 CTGGGGAAAGAGAACAAGAGAGG + Intergenic
1111165987 13:84457415-84457437 AAAGGTAAACAGGAGATGAGTGG + Intergenic
1111732064 13:92088520-92088542 CAGGTGAAAGAGGTGAGGAGGGG - Intronic
1112392829 13:99000970-99000992 AAGGCGCAACAGCAGAAGAGAGG + Intronic
1112423920 13:99279123-99279145 AAGGGGGAAAAGGAGAAAAGAGG - Intronic
1112683576 13:101796319-101796341 CAGGGGAGGCAGGATCAGAGTGG - Intronic
1113585201 13:111459977-111459999 GAGGGGAAGAAGGAGAGGAGTGG + Intergenic
1113646313 13:111998946-111998968 CGGGGGATGCAGGAGGAGAGAGG + Intergenic
1113674175 13:112196521-112196543 CAGGGGAACCAGGAAACCAGGGG - Intergenic
1113674181 13:112196538-112196560 CAGGGGAACCAGGAAACCAGGGG - Intergenic
1114786384 14:25604580-25604602 CAGGAGAAAAAGGAAAAGAAAGG + Intergenic
1114948754 14:27719766-27719788 CAAGGAAACCTGGAGAAGAGAGG + Intergenic
1115862072 14:37698624-37698646 CATGTGAAAGAGGAAAAGAGAGG - Intronic
1115871118 14:37803631-37803653 CAGGTGAGGCAGGAGAAGATGGG + Intronic
1116804968 14:49484884-49484906 CATGGGAGTCAGTAGAAGAGTGG + Intergenic
1117621577 14:57592749-57592771 AAGGGTAAACAGAGGAAGAGAGG - Intronic
1118284014 14:64454700-64454722 CTGGGGAAAGAAGGGAAGAGAGG - Intronic
1118893129 14:69925233-69925255 GAGGGGAAGCAGGGGAGGAGGGG + Intronic
1119162487 14:72464645-72464667 CAGGGAAAACAGTAGATGAATGG - Intronic
1119483497 14:74974225-74974247 CAGGAGACACAGGAGAGGACTGG - Intergenic
1119954574 14:78782947-78782969 AGGAGGAAACAGGAAAAGAGAGG + Intronic
1120599718 14:86487097-86487119 GAGGAGAAGGAGGAGAAGAGAGG + Intergenic
1120914828 14:89701776-89701798 CAGGGGAAGTAGGTGAAGGGTGG - Intergenic
1121447574 14:93988364-93988386 CATGGGAGAGAGGACAAGAGAGG + Intergenic
1121602773 14:95218421-95218443 CAGGGGAGAGAGGAGAGGACAGG + Intronic
1121801488 14:96777880-96777902 CAGGGATAAGAGGAGAGGAGTGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122784807 14:104158718-104158740 CAGAGGGAACAGGAGAGCAGAGG + Intronic
1123042609 14:105496521-105496543 CGGGGGAAGCAGGGGTAGAGTGG + Intronic
1123116630 14:105897775-105897797 CAGGGTAAACAGAAAATGAGAGG - Intergenic
1123440798 15:20289719-20289741 CAGGGGCAGCAGGTGGAGAGCGG + Intergenic
1123768938 15:23509850-23509872 CAGGGGCAACAGCAGAATTGGGG + Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1125228478 15:37424544-37424566 CAGGGGAAAGGGCAGGAGAGGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125326116 15:38537545-38537567 CAAGGGAAGCAGGAGCAGTGGGG + Intronic
1125523435 15:40360675-40360697 CAGAGGATACGGGAGAAGAGTGG - Intronic
1126104175 15:45136506-45136528 CTGGGGAAATAGGAGAAGAGAGG - Intronic
1126167615 15:45666959-45666981 GAGGGGAGAAAGGAGAGGAGAGG - Intronic
1126662847 15:51049141-51049163 CATGGGAACCATGAGAAAAGTGG - Intergenic
1126675106 15:51154224-51154246 AAGGTGAAACAGGAGCAGACAGG + Intergenic
1127392867 15:58521165-58521187 CAGGGGGAAGGGGAGAACAGAGG - Intronic
1127397220 15:58552497-58552519 CGGGGAAGACAGGAGAAGAGTGG - Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1128240758 15:66099596-66099618 AAGGGGAAACAGGACCAGAGAGG - Intronic
1128749976 15:70141827-70141849 CATGGGACCCACGAGAAGAGTGG + Intergenic
1128853187 15:70983001-70983023 CAGGGCCAGCAGGTGAAGAGGGG + Intronic
1129049875 15:72772122-72772144 CACAGGAAACAGGAAAAGTGTGG + Intronic
1129444562 15:75607891-75607913 CAGGGCAGAGGGGAGAAGAGAGG + Intronic
1129509278 15:76108662-76108684 CCTGGGAACCAAGAGAAGAGAGG + Intronic
1130192421 15:81749804-81749826 CAGAGGAAGCAGGAGAGGAAAGG + Intergenic
1130193252 15:81756023-81756045 CAGAGAAAACAAGAGAAGAGAGG + Intergenic
1130854067 15:87825375-87825397 CAGTGGAAAGAGGGAAAGAGTGG - Intergenic
1131504579 15:93005310-93005332 AAAAGGTAACAGGAGAAGAGGGG + Intronic
1131893414 15:96999549-96999571 GAAGGAAAACAGGAGCAGAGAGG - Intergenic
1132259605 15:100410965-100410987 CTGGGGAAAGGGGAGAAGTGGGG - Intronic
1132261473 15:100428905-100428927 CAGGAGTAGCCGGAGAAGAGTGG + Intronic
1132540183 16:504820-504842 AAGGGGGTACAGGAGATGAGGGG - Intronic
1132988787 16:2782543-2782565 AAGGGGAAACAGGCCCAGAGAGG - Intergenic
1133210304 16:4260009-4260031 TAGGGGAGACTGGAAAAGAGGGG - Intronic
1133527410 16:6619026-6619048 CAGGGGATCAGGGAGAAGAGTGG + Intronic
1133588311 16:7217073-7217095 AAAGGGAAACAGGGGAGGAGAGG - Intronic
1133604481 16:7372750-7372772 CAATGGGAAAAGGAGAAGAGAGG + Intronic
1134060834 16:11198577-11198599 GAGGGGAAAAAGGAGAGGAGAGG + Intergenic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134231133 16:12431238-12431260 AAGGGGGAAGAGGGGAAGAGCGG + Intronic
1134238583 16:12487049-12487071 AAGGGGAAACAGGCACAGAGAGG - Intronic
1134271541 16:12737314-12737336 CATGGGAAGAAGGAGAAGAAGGG + Intronic
1134464918 16:14467033-14467055 CAGGGGCATCAGGAAAAGCGGGG - Intronic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135201516 16:20441710-20441732 GAGGAGAAAAAGGAGAAAAGAGG - Intergenic
1135217592 16:20586156-20586178 GAGGAGAAAAAGGAGAAAAGAGG + Intergenic
1135721528 16:24822255-24822277 CAGAGGAAACAGCAGAGGAGTGG + Intronic
1135796863 16:25453450-25453472 CAGGGGAAAAAAAAGAAAAGAGG - Intergenic
1136726057 16:32358671-32358693 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1137486707 16:48897262-48897284 CAGGAGAAACAGGAGGTAAGTGG + Intergenic
1137548013 16:49417344-49417366 GAGTTGAAGCAGGAGAAGAGAGG + Intergenic
1137788838 16:51157393-51157415 AAGGGGAAGAGGGAGAAGAGTGG - Intergenic
1137977289 16:53042406-53042428 GAGGGGAAACAGAGGAAGAGAGG - Intergenic
1138427686 16:56947111-56947133 CAGGAGTGACAGGCGAAGAGAGG + Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1138578426 16:57923536-57923558 GAGGGAAAACGGCAGAAGAGAGG + Intronic
1138961595 16:62035626-62035648 CAGGGAAAAAAGGAGGCGAGGGG - Intronic
1139320312 16:66109218-66109240 CTGGGGACCCTGGAGAAGAGAGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1140602236 16:76491129-76491151 GAGGAGAAAGAGGAGAAGAAGGG - Intronic
1140689672 16:77469691-77469713 CATTTGGAACAGGAGAAGAGAGG - Intergenic
1140891379 16:79288113-79288135 AAGGGGAAGCAGGGGAGGAGTGG + Intergenic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1140961213 16:79914911-79914933 CAGGGGAAGAAGGAGAAATGAGG + Intergenic
1142069905 16:88086427-88086449 CAGGGGAGACGGCAGAACAGGGG - Intronic
1142320885 16:89382159-89382181 CAGGGGAAAGAGGAGATGGGTGG - Intronic
1203000374 16_KI270728v1_random:159085-159107 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203131976 16_KI270728v1_random:1695488-1695510 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203154556 16_KI270728v1_random:1865015-1865037 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142698694 17:1646996-1647018 CAGAGGAGAGAGGAGAAGTGAGG + Intronic
1143071576 17:4299764-4299786 CAGGTAAAATAGAAGAAGAGGGG - Intronic
1143216612 17:5229850-5229872 GAGAGGAGAAAGGAGAAGAGGGG - Intronic
1143397078 17:6609229-6609251 CAGGGGAGAAGGGAGAAGATAGG - Intronic
1143445126 17:7004588-7004610 AAGGAAAAGCAGGAGAAGAGGGG + Intronic
1143478906 17:7217612-7217634 AAGGGGAGAGAGGAGGAGAGAGG + Intronic
1143563579 17:7708845-7708867 TACAGGAAAGAGGAGAAGAGAGG + Intronic
1143625020 17:8104723-8104745 AAGGGGCACCAGGAGCAGAGTGG + Intronic
1144214684 17:13044825-13044847 CTGAGAAAAAAGGAGAAGAGAGG + Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1145977471 17:28992719-28992741 GAGGGGACACTGGAGGAGAGAGG - Intronic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146540878 17:33693639-33693661 CAGGAGAATAAAGAGAAGAGGGG + Intronic
1146890855 17:36505668-36505690 GAGGGGAAAGAGGAGGAGATTGG - Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147445722 17:40474278-40474300 GAGGGGAAGTGGGAGAAGAGAGG + Intergenic
1148113663 17:45162146-45162168 AAAGGGAAACAGGAGAAAAGGGG - Intronic
1148153815 17:45411472-45411494 CAGTGGGTACAGGAGAAGAGGGG - Intronic
1148220184 17:45855586-45855608 CAGGGGAGTCAGGGAAAGAGAGG + Intergenic
1148342033 17:46878959-46878981 CAGGGGTAACTGGAAAAGAAAGG - Intronic
1148616656 17:49005599-49005621 TAGAGGAGGCAGGAGAAGAGGGG + Intronic
1148617973 17:49014351-49014373 CAGGGGAAAGCGCAGCAGAGCGG - Intronic
1148914724 17:50966246-50966268 CATGGGAAACAGGTGGAGATGGG - Exonic
1149206449 17:54253623-54253645 CAGTGGAAAAGAGAGAAGAGCGG - Intergenic
1149492185 17:57092952-57092974 GGGGGGAAGCAGGAGGAGAGCGG - Intronic
1149502693 17:57166505-57166527 CTGGGGAAAGAGGAGGAGTGGGG + Intergenic
1149576402 17:57716365-57716387 AAGGGGAAGCAGGAGAAGAGCGG + Intergenic
1149783292 17:59415207-59415229 CAAGGGAAACAGCAGAAGAGAGG + Intergenic
1149899800 17:60464627-60464649 TAGGGGAAACAGGTGTAGAGAGG + Intronic
1150271595 17:63869501-63869523 AAGGAGAAAAAGGAGATGAGAGG - Intergenic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1151362952 17:73599573-73599595 GAGGGAAAAGAGGAGGAGAGAGG + Intronic
1151530802 17:74703483-74703505 CAGCAAAAACAGGAGCAGAGTGG + Intronic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1151765303 17:76130663-76130685 CAGGAGCAAGAGGAGCAGAGAGG - Intergenic
1152083959 17:78205918-78205940 CAGGGGAGACATGGGAAGAGGGG - Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152881922 17:82822504-82822526 CAGCGGAAAGAGCAGAAGAGTGG + Intronic
1152900367 17:82937653-82937675 CAGGGCACACAGGAGAATCGGGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1203171691 17_GL000205v2_random:154191-154213 CAGGGGGAGCAGGAAAGGAGGGG - Intergenic
1155289380 18:24325348-24325370 CAGGGCGAGCTGGAGAAGAGTGG - Intronic
1155349716 18:24894663-24894685 CAGATGAAGCAGGTGAAGAGAGG + Intergenic
1156002641 18:32402610-32402632 CAGGGGGAACAGGCTAAGGGTGG - Intronic
1156278616 18:35610190-35610212 CATGGGAAAGAGGTGCAGAGTGG + Intronic
1156463245 18:37333371-37333393 GAGGGGAAAGAGGGGAAGAAGGG - Intronic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1157192669 18:45594526-45594548 CAGGAGAGAAAGGAGAGGAGGGG - Intronic
1157372760 18:47132058-47132080 AAGGGGAAGCAAGGGAAGAGGGG - Intronic
1157773969 18:50375576-50375598 CAGGGGAAAGAGGATAAGCCTGG - Intronic
1158038686 18:53066925-53066947 CAGGAGAAACAGAGAAAGAGGGG + Intronic
1158205334 18:54986412-54986434 CTGAGGAGACAGGAGAGGAGAGG - Intergenic
1158455509 18:57603782-57603804 GAGAGGTAACAGGAGATGAGTGG + Intronic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1158993939 18:62898010-62898032 GAGGAGAAAGAGGAGAAGGGAGG - Intronic
1159485668 18:69053450-69053472 GAGGGGAAATGGGAGAAGAGTGG + Intronic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1160175679 18:76592265-76592287 CTGAGGAAACAGGGGATGAGGGG - Intergenic
1160309756 18:77778425-77778447 CAAGGGACAAAGAAGAAGAGGGG + Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1161415632 19:4145162-4145184 AAGGGGAGACGGGAGAGGAGAGG + Intergenic
1161437643 19:4273227-4273249 CTGGGCTTACAGGAGAAGAGGGG + Intergenic
1161539231 19:4839602-4839624 CCAGGGAAAGAGGGGAAGAGGGG + Intronic
1161765303 19:6204575-6204597 CAGAAGAAACAGGACAAGAGAGG + Intergenic
1162578516 19:11513564-11513586 CAGGGAGGAGAGGAGAAGAGAGG + Intronic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163351119 19:16777344-16777366 GAGGGGAAAGAGGAGAGAAGGGG + Intronic
1164064671 19:21705641-21705663 CAGGGTGAAAAGGAAAAGAGGGG + Intergenic
1164249795 19:23466689-23466711 AAGGAGAAAGAGGAGGAGAGGGG - Intergenic
1164249964 19:23467778-23467800 GAGGAGAAAAAGGAGAGGAGGGG - Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164861484 19:31565462-31565484 CAGTGGAAACAGGAAATGGGTGG + Intergenic
1165450985 19:35882678-35882700 CAGGTGAAACAGGAAAAGTAAGG + Intergenic
1165749405 19:38251148-38251170 CAGAGGCCACAGGAGGAGAGAGG + Intronic
1166316627 19:41993160-41993182 AGGGGGAATCAGGAGAGGAGGGG - Intronic
1166356503 19:42230475-42230497 CAAGGGACACAGGAGGGGAGGGG + Exonic
1166524916 19:43504764-43504786 CAGGGGAAGAGGGAGGAGAGAGG + Exonic
1166831978 19:45644684-45644706 GAGGGGAGATAGGAGAAGAGGGG - Intronic
1167165828 19:47799213-47799235 CAGAAGAAGCAGGAGAGGAGAGG + Intergenic
1167547921 19:50140351-50140373 GACGGGAGACAGGAGACGAGAGG - Intergenic
1167674407 19:50875489-50875511 AAGGGGAAACAAGAAAGGAGGGG + Intronic
1167682961 19:50936611-50936633 AAGGGCAAACAGGCGAACAGAGG - Intergenic
1167798178 19:51724267-51724289 CAGGGGAGACAAGGGACGAGAGG - Intergenic
1168063289 19:53906157-53906179 CAGGGGAAACAGGCAAATGGAGG - Intronic
1168593105 19:57652909-57652931 CAGGGGTAAGAGGGGAGGAGAGG - Intergenic
924964728 2:65268-65290 CAGGGGAAAGAGGAAGACAGTGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925011679 2:490210-490232 AAGGGGAAACTGGATAAGAGGGG - Intergenic
925158586 2:1665211-1665233 CAGAGGGCACAGGAGAAGATGGG + Intronic
925180020 2:1811526-1811548 CAGGGCAAGCAGGAGAAGCCAGG - Intronic
925215328 2:2089784-2089806 GAGGGGAGAGAGGAGAGGAGTGG - Intronic
925412394 2:3647528-3647550 CAGGGGCATCAGGAGAAGATGGG - Intergenic
925412404 2:3647562-3647584 CAGGGGCATCAGGAGAAGATGGG - Intergenic
925412414 2:3647596-3647618 CAGGGGCATCAGGAGAGGACGGG - Intergenic
925412425 2:3647630-3647652 CAGGGGCATCAGGAGAGGACGGG - Intergenic
925412436 2:3647664-3647686 CAGGGGCATCAGGAGAGGACGGG - Intergenic
925679787 2:6408509-6408531 CAGGTAAAATAGGAGAAGAAAGG + Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927294714 2:21440790-21440812 CAGCTGAAACAGGGGAAGATTGG + Intergenic
927423932 2:22960062-22960084 CATGAGAAACAAGAGAAGACAGG + Intergenic
927475978 2:23414468-23414490 CAGGGGAAGCAGGTGTGGAGTGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928627810 2:33158791-33158813 TAGGGGAAAAGGGAGAGGAGTGG - Intronic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
928959811 2:36912490-36912512 CAAGGAAACCAAGAGAAGAGAGG - Intronic
929402075 2:41595781-41595803 TATGGGAAAGAGGAGCAGAGTGG - Intergenic
929579343 2:43071786-43071808 GTGGGGAAAGAGGGGAAGAGGGG - Intergenic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
929654338 2:43715575-43715597 AAGGGGTTACAGGAAAAGAGAGG + Intronic
929983101 2:46699206-46699228 GAGGGGAAACGGGTGAAGAAGGG + Intronic
930858669 2:56045930-56045952 CAGGGGAACCAGGTGAAGTGTGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930978197 2:57490005-57490027 CTAGGTAAACAGGAGAGGAGAGG + Intergenic
931309806 2:61066659-61066681 CAGTGGAAAGATGGGAAGAGAGG - Intronic
931869524 2:66443870-66443892 GAGGGAAGACAGGAGAGGAGAGG - Intronic
932288496 2:70555375-70555397 CCTGGGGAACAGGAGAAGGGTGG - Intergenic
932369361 2:71174637-71174659 GAGGTGAAAGAGGAGGAGAGTGG + Intergenic
932674861 2:73770832-73770854 CAGGAGAAACGGGATCAGAGAGG - Intronic
932770680 2:74499264-74499286 ACGGGGAACCAGGAGGAGAGAGG + Intronic
933422919 2:82074885-82074907 GAGGGGAAAGAAGAGAAGAGGGG - Intergenic
934127545 2:88913074-88913096 CAGGAGAAACATGAGAAGCTGGG + Intergenic
934319830 2:91961910-91961932 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
935165940 2:100568663-100568685 GAGGCGGAATAGGAGAAGAGAGG + Intronic
936047817 2:109200668-109200690 CAGGGACACCAGGAGAAAAGAGG - Intronic
936284975 2:111174821-111174843 CAGGAGCAACCAGAGAAGAGCGG + Intergenic
936403654 2:112184263-112184285 AAGGGAGAACGGGAGAAGAGAGG + Intronic
936438737 2:112531551-112531573 CCGGGGGTACAGGGGAAGAGTGG - Exonic
937091837 2:119211753-119211775 GAGGAGAAACAAGAGAAGATTGG + Intergenic
937259172 2:120574522-120574544 CAGGGGACACAGGAAATGAGAGG - Intergenic
937263034 2:120598453-120598475 CAGGGGCTACAGGAGGAAAGCGG + Intergenic
937825616 2:126365597-126365619 CAGAGGAACCAGGAGAAAATGGG - Intergenic
938069356 2:128300322-128300344 GATGGGACACTGGAGAAGAGGGG + Intronic
938419827 2:131136213-131136235 CAGGGGAGAGAGGAGAGGAGAGG - Intronic
938982521 2:136540016-136540038 CAGGGGTAACAGGGTGAGAGAGG + Intergenic
939321780 2:140632564-140632586 CAGAGGAGATAGGAAAAGAGAGG + Intronic
939629095 2:144513454-144513476 AAAGGGAAATAGGAGAAGAAAGG - Intronic
940420773 2:153477748-153477770 GGGGGGGAGCAGGAGAAGAGTGG + Exonic
940610579 2:155986076-155986098 CAGGGGCAACAGTTGAACAGAGG + Intergenic
940842323 2:158598420-158598442 CAGAGGAACCAGGAGAAAATTGG + Intronic
941650122 2:168083570-168083592 CATGGGAATCTGCAGAAGAGAGG + Intronic
941730516 2:168912261-168912283 CAGGGGCAACTGGACACGAGCGG - Intronic
942275125 2:174315833-174315855 CAGGGGAAAGAGTGGAAGGGGGG + Intergenic
942720603 2:178948472-178948494 AAGTGGAGTCAGGAGAAGAGCGG + Intronic
943528673 2:189051326-189051348 AAGGGGACCCAGGAGAAGATGGG - Exonic
944212663 2:197222528-197222550 AAGGGGAAAACAGAGAAGAGAGG - Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946202887 2:218081217-218081239 CAGGGAAGGTAGGAGAAGAGTGG - Intronic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
946347156 2:219119803-219119825 CCAAGGAAACAGGAGAAGATTGG - Intronic
946391201 2:219418057-219418079 CAGGGGAGACAGCAGAAGAGAGG - Intergenic
946506783 2:220309776-220309798 GAGGGGAAAGTGAAGAAGAGAGG + Intergenic
946729563 2:222695910-222695932 CGGGGGAAAGAGTGGAAGAGGGG - Intronic
946812000 2:223535763-223535785 CAGAGGAACCAAGAAAAGAGTGG - Intergenic
947476246 2:230450065-230450087 AAGTAGAAACAGGAGAAGAAAGG + Intronic
947648449 2:231763339-231763361 CAAGGAAAAAAGGAGAATAGAGG - Intronic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948041995 2:234909513-234909535 CAGGAGATGCAGGAAAAGAGAGG + Intergenic
948265413 2:236632204-236632226 CAGGGGGACCAGGCGAAGAGGGG + Intergenic
948372885 2:237501488-237501510 TGGGGGAAATAGGAGATGAGAGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168788106 20:557163-557185 GAGAGGAAGCAGGAGAGGAGTGG + Intergenic
1169063947 20:2682161-2682183 AAGGGGAAGAAGGAGAAGAAGGG + Intergenic
1169066648 20:2697755-2697777 CAGGGGAGTCAGGGGAAGATGGG - Intronic
1169255157 20:4091509-4091531 CCCGGGAAAGAGGAGGAGAGAGG + Intergenic
1169449128 20:5696400-5696422 CAAGGGAAACATGAGGACAGTGG + Intergenic
1169734343 20:8821894-8821916 CAGCAGAAACAGGAGAAGCATGG - Intronic
1169922468 20:10749888-10749910 TAGGAGAAATAGGAGAAGACTGG - Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1172093895 20:32451418-32451440 CAAGGGAAGCAGGGGAGGAGTGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172826222 20:37788865-37788887 CAGGGAAAACTAGAGGAGAGAGG - Intronic
1172909777 20:38399389-38399411 GAGGGCAAACAGGAGAAAAGGGG + Intergenic
1173032799 20:39377996-39378018 CAGGTGAAAGAGGAAAAGAAAGG - Intergenic
1173402703 20:42739326-42739348 AAGGGAGAACAGGGGAAGAGAGG + Intronic
1173622546 20:44447930-44447952 CAGAGCAAACAGGAAGAGAGAGG + Intergenic
1174137072 20:48387077-48387099 CAGGGAGGACAGGAGAAGTGGGG - Intergenic
1174495028 20:50933525-50933547 TAAGGGAAACAGAACAAGAGTGG + Intergenic
1174850585 20:53990208-53990230 CTGGGGAAACCTGAGGAGAGAGG + Intronic
1175031342 20:55957562-55957584 GAGGAGAAAGAGGAGAAGGGTGG - Intergenic
1175319921 20:58078417-58078439 CAGGGGGAAGAAGAGAAGAAAGG + Intergenic
1175531041 20:59674460-59674482 AAGGGGGAACAGGAGAAGAGAGG - Intronic
1175531056 20:59674520-59674542 AAGGGGAGACAGAAGAAGCGGGG - Intronic
1175531066 20:59674564-59674586 AGGGGGGAACAGGAGAAGCGGGG - Intronic
1175531076 20:59674595-59674617 AGGGGGGAACAGGAGAAGCGGGG - Intronic
1175531105 20:59674707-59674729 GAGGGGGAACAGGAGAAGGGGGG - Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175531148 20:59674844-59674866 AAGGGGCAACAGGAGAAGGCAGG - Intronic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175741719 20:61424644-61424666 GAGTGAAAACAGGGGAAGAGTGG - Intronic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1175988564 20:62776471-62776493 CACGGGGAACAGGAGCACAGGGG + Intergenic
1176125478 20:63472862-63472884 GAGGGGAGACAGGAGGGGAGGGG + Intergenic
1176125507 20:63472934-63472956 GAGGGGAGACAGGAGTGGAGGGG + Intergenic
1176327672 21:5516026-5516048 CAGGGGGAGCAGGAAAGGAGGGG - Intergenic
1176400085 21:6304925-6304947 CAGGGGGAGCAGGAAAGGAGGGG + Intergenic
1176407545 21:6429656-6429678 CAGGGGTTACAGAAGAAGCGTGG + Intergenic
1176437072 21:6684179-6684201 CAGGGGGAGCAGGAAAGGAGGGG - Intergenic
1176461334 21:7011249-7011271 CAGGGGGAGCAGGAAAGGAGGGG - Intergenic
1176484895 21:7393027-7393049 CAGGGGGAGCAGGAAAGGAGGGG - Intergenic
1177259192 21:18706944-18706966 AAGGGGAAAAGGGGGAAGAGGGG - Intergenic
1178019039 21:28388380-28388402 AAGGGAGAAAAGGAGAAGAGAGG - Intergenic
1178294240 21:31395446-31395468 CAGGGAAAATTGGACAAGAGGGG + Intronic
1178360824 21:31947530-31947552 CTGGGGAGACAGGAGAGGAATGG - Intronic
1178576085 21:33792922-33792944 AAGGGGAAAATGGAGAAGAAGGG - Intronic
1178950601 21:36982313-36982335 CAGGGGCTCCAGGAGACGAGTGG - Intronic
1179277792 21:39907868-39907890 TAGGTGGAGCAGGAGAAGAGAGG + Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1179933878 21:44590660-44590682 CAGGGGTAACAGGAGGGGTGAGG + Intronic
1179941017 21:44638880-44638902 CAGGGGTAACAGGAGGGGTGAGG - Intronic
1180308080 22:11145954-11145976 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180546556 22:16507767-16507789 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180729861 22:17973148-17973170 GGGGGGAAAAGGGAGAAGAGAGG + Intronic
1180974230 22:19837941-19837963 AAAGGGAACCTGGAGAAGAGAGG + Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181558913 22:23688390-23688412 TGGGGGAAACAGGAGATGAGGGG + Intronic
1182212627 22:28689587-28689609 CAGGGGCAGCAGGTGGAGAGTGG - Intronic
1182540420 22:31037540-31037562 CAGGGGAAACAGGCTCAGAGAGG - Intergenic
1182675731 22:32037825-32037847 CAGGGGAAAGACGGGGAGAGGGG + Intergenic
1182770107 22:32788896-32788918 CTGGGGAAAGGGGAGAGGAGTGG + Intronic
1183160969 22:36112907-36112929 CAGGACACAGAGGAGAAGAGGGG - Intergenic
1183259594 22:36785914-36785936 GAAGAGAAGCAGGAGAAGAGGGG - Intergenic
1183268565 22:36846590-36846612 GGGGAGAAACAGGAGAGGAGAGG - Intergenic
1183422551 22:37720474-37720496 CAGGGGAAACTGGAAGAGATGGG - Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183851177 22:40589515-40589537 CAAGGGATACATGAGAAGACTGG + Intronic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184352880 22:43956033-43956055 CACGGTAGACAGGAGAAAAGAGG - Intronic
1184481918 22:44752876-44752898 CAGGGGAAAAAGCAGAGGAGGGG - Intronic
1184563933 22:45279968-45279990 GAGGGGAAACAGGAGAAAAAGGG - Intergenic
1185015279 22:48339236-48339258 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1185345161 22:50307715-50307737 CGGGGAGAACAGGAGAAGGGGGG + Intergenic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949807671 3:7973659-7973681 CAGGGGAGAGGGGAGGAGAGAGG + Intergenic
950657191 3:14443946-14443968 CAGGGAAAGCAGGGAAAGAGAGG - Intronic
950684720 3:14608315-14608337 CAAGGGAAGCAGGACAGGAGAGG - Intergenic
950797494 3:15521834-15521856 CATGGGAGACAGGAGAGGTGGGG - Intergenic
951670062 3:25171201-25171223 CAAGGCAAACAGGAGCTGAGTGG - Intergenic
951825485 3:26863702-26863724 CAGGGCAAACAGGACAGGATTGG + Intergenic
952150631 3:30586249-30586271 GTGGGTAAATAGGAGAAGAGTGG - Intergenic
952167883 3:30770804-30770826 CAACAGAAACAAGAGAAGAGAGG + Intronic
953350191 3:42209720-42209742 AAGGGGGACAAGGAGAAGAGAGG - Intronic
953369518 3:42375618-42375640 CCGGGGAGACAGGACTAGAGAGG + Intergenic
953479157 3:43234528-43234550 CTGGGGAAAGAGGAGGAGTGAGG - Intergenic
953507700 3:43502440-43502462 GAGAGGAAGCAGGAGAAGCGGGG - Intronic
953641352 3:44711120-44711142 AAGGGGAAACCGGTGCAGAGGGG - Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
954388826 3:50258446-50258468 GAGAGGAAAGAGGAGAAAAGCGG - Exonic
954411830 3:50374280-50374302 GAGGGGAAAGGGGAGAGGAGAGG + Intronic
955720961 3:61880745-61880767 CTTGGGATATAGGAGAAGAGGGG + Intronic
955813281 3:62814824-62814846 CAGCTGAAAGAGGAAAAGAGTGG - Intronic
955950192 3:64235961-64235983 CAGGGGTACCTGGAGAAGAGAGG + Intronic
956201764 3:66713809-66713831 CAGGGATAACAGGACAGGAGGGG - Intergenic
956240845 3:67128470-67128492 CAGGGGAAAGGGTAGGAGAGGGG + Intergenic
957360113 3:79144438-79144460 AAGGGGAAAGAGGAAAAAAGTGG - Intronic
957899930 3:86476200-86476222 AAGGAGAAGAAGGAGAAGAGAGG + Intergenic
958516570 3:95123680-95123702 CATGGAAAACAGGAAAAGAAGGG + Intergenic
958658523 3:97035244-97035266 CAGGGGAAAAGGGAGCTGAGAGG - Intronic
959626995 3:108463811-108463833 TAGGGGAAGAAGTAGAAGAGAGG + Intronic
959715767 3:109431298-109431320 GTGGGGATACAGGGGAAGAGTGG - Intergenic
959939323 3:112063955-112063977 CAGTGGCAAAAGGAAAAGAGGGG + Intronic
960036147 3:113104905-113104927 CAGAGGTTAAAGGAGAAGAGGGG - Intergenic
960245951 3:115400640-115400662 CATGGGAGTCAGGAGCAGAGAGG - Intergenic
960587529 3:119334206-119334228 CAAGCCAAACAGGAGATGAGGGG - Intronic
960896382 3:122510280-122510302 CAGGGGAACCAGTACAAAAGAGG + Intronic
960967287 3:123114152-123114174 CAGGCGAAACAGGAAGAGAGAGG + Intronic
960986546 3:123284739-123284761 GTGGGGGAACAGGAGGAGAGAGG + Intronic
961312692 3:126013822-126013844 TAGGGGAAACAGGACGAGCGGGG + Intronic
961352935 3:126315553-126315575 CAGGGGGGACAGGAGGAGAGCGG + Intergenic
961491467 3:127259301-127259323 GATGGGAAACAGGAGGTGAGGGG + Intergenic
961504012 3:127358239-127358261 CAGGGGAAAGAGGAGGCAAGGGG - Intergenic
961511927 3:127408615-127408637 CTGAGGACACAGGGGAAGAGAGG + Intergenic
961541216 3:127600730-127600752 GAGGGGAAACAGCAGAGGAGGGG - Intronic
962280523 3:134048672-134048694 CACGGCAAACAGGGGAAGGGTGG - Intronic
962504937 3:136036993-136037015 CATAGGAAAGAGGAGAAGAGAGG + Intronic
963044138 3:141090094-141090116 ACTGGGAAGCAGGAGAAGAGAGG - Intronic
963108220 3:141664501-141664523 AGGGGGAAAGAGGAGAGGAGAGG + Intergenic
963346600 3:144102405-144102427 CAGGAGAAGCAGTAGAAAAGTGG - Intergenic
963705947 3:148688499-148688521 CACTGGAATCAGGAGATGAGTGG - Intergenic
964186986 3:153957980-153958002 GAGGGAAGACAGGAGAGGAGAGG - Intergenic
964206357 3:154179340-154179362 AAGGAGAAAAGGGAGAAGAGAGG - Intronic
965121604 3:164565532-164565554 CAGTGTAAAAAGGAGAAGATGGG - Intergenic
965387193 3:168058980-168059002 GAGGGGAAGCGAGAGAAGAGGGG + Intronic
965456744 3:168910871-168910893 AATGGAAAACAGGAGAAGGGTGG - Intergenic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
965727676 3:171736316-171736338 AAGAGGAAACAGGAACAGAGAGG + Intronic
966001417 3:174953338-174953360 AAGGGGAAAGAGGAGGGGAGGGG - Intronic
966551741 3:181212885-181212907 CCTGGGACCCAGGAGAAGAGAGG - Intergenic
966775916 3:183542474-183542496 GAGGGGAGAAAGGAGAAGAGAGG - Intronic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
967826195 3:193879499-193879521 CAGAGGAATGAGGAGAAGAGGGG + Intergenic
967877042 3:194274582-194274604 CAGGGAAAAGAGGACAAAAGTGG + Intergenic
967993726 3:195151078-195151100 CAGGGAAACCAGGGTAAGAGAGG - Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968229463 3:196996769-196996791 CAGCTGAAACAAGAGAAGACAGG + Intronic
968577785 4:1376017-1376039 GAGGGGCTACAGGAGCAGAGTGG - Exonic
968771991 4:2513330-2513352 CAGGGCATACAGGAGTATAGGGG - Intronic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969543179 4:7806690-7806712 CAGGGGAAAGGGGAGAGGGGAGG - Intronic
969688041 4:8687921-8687943 CTGAGGAAACAGGATCAGAGAGG + Intergenic
969717879 4:8877238-8877260 GAGGGGAGAGAGGAGAGGAGTGG + Intergenic
970208631 4:13683081-13683103 CAGGGGTTAGAGGACAAGAGAGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971478197 4:27091496-27091518 TAGGGGAAACTGGAGAGAAGAGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
971505738 4:27364826-27364848 TATGGGAAACAGGTGCAGAGAGG - Intergenic
971505909 4:27366275-27366297 TATGGGAAACAGGTGCAGAGAGG + Intergenic
972299332 4:37770439-37770461 CAGGGGAGAAGGGAGGAGAGAGG - Intergenic
973563597 4:52161935-52161957 CAGGAGACAGAGGAGAAAAGTGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973796702 4:54434618-54434640 CAGGGGAGCTGGGAGAAGAGTGG - Intergenic
973815711 4:54617116-54617138 CAGAGGAAAGAAGAGAAGAATGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975822118 4:78282112-78282134 GAGGTGAAACAGGAGAAAACAGG - Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976530825 4:86150293-86150315 CAGGAGAAAAAGGGTAAGAGGGG + Intronic
977061397 4:92261450-92261472 CTGGGGAAAAAAGTGAAGAGAGG - Intergenic
977293881 4:95191574-95191596 CAGGGGAGAAAGGTGAATAGAGG - Intronic
978624508 4:110669407-110669429 GAGGGGGAAGAGGAAAAGAGAGG - Intergenic
978895261 4:113879112-113879134 CAAGGGAGACAGCAGAAGTGAGG - Intergenic
979118726 4:116864904-116864926 CAGGGGAAAAGGGAAAAGAGGGG + Intergenic
979559833 4:122089310-122089332 GAGGGGAAGAAGGAGAAGAGAGG - Intergenic
979833498 4:125330898-125330920 AAGGGGAATCAGGAAAAAAGAGG - Intronic
979938867 4:126734021-126734043 CAAGGATAATAGGAGAAGAGAGG - Intergenic
979979185 4:127233902-127233924 AATGGGCAACTGGAGAAGAGCGG - Intergenic
980098047 4:128513197-128513219 GAGGTCAAACAGGAAAAGAGTGG - Intergenic
980144786 4:128968916-128968938 CAGGGGAATCTGTAGAAGCGAGG - Intronic
980328838 4:131384804-131384826 GAGGAGAAAGAGGAGAAAAGAGG - Intergenic
981091466 4:140736849-140736871 CAGGGGAATGGAGAGAAGAGTGG - Intronic
981166165 4:141560250-141560272 CAGTGGAAAAGGCAGAAGAGGGG + Intergenic
981610118 4:146584560-146584582 CAAAGCAAGCAGGAGAAGAGAGG - Intergenic
981891339 4:149741629-149741651 CAGGGGTAACAGGAGCCAAGAGG + Intergenic
982139437 4:152304108-152304130 CAATGGAAACAGGCCAAGAGGGG - Intergenic
982343609 4:154331945-154331967 CAGGGGAACCAGAGGAAAAGGGG - Intronic
982885389 4:160773581-160773603 TAGGAGAAACAGGTGAGGAGGGG + Intergenic
983046001 4:162986566-162986588 CCGGGGAAACAAGAAGAGAGAGG + Intergenic
984838619 4:184047437-184047459 TATGGCAAACAGGAGAGGAGAGG - Intergenic
984990712 4:185378080-185378102 CAGTGGAAAAAGGAAAAGACTGG - Exonic
985533073 5:444996-445018 CAGATGAAAAAGGAGAAGAGAGG + Intronic
985614279 5:910281-910303 CCGGGGAGACAGGAGAATGGAGG - Intronic
985680878 5:1254973-1254995 CAGGGCAAACAGGAGAGGCCAGG + Intronic
985819937 5:2152908-2152930 AAGGAGAGACAGAAGAAGAGAGG - Intergenic
986534510 5:8773233-8773255 CAGGGGACACTGGGGAAGATGGG - Intergenic
986663063 5:10076283-10076305 GAGGGGATCAAGGAGAAGAGGGG - Intergenic
986770741 5:10970740-10970762 CAGAGGAAAGAGGGGAAGCGAGG - Intergenic
987154143 5:15071005-15071027 CAGGAGATTCAGGAGAAGAGAGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987937289 5:24482426-24482448 ATGGGAAAACAGCAGAAGAGAGG + Intergenic
988553271 5:32215945-32215967 CATGGAGATCAGGAGAAGAGAGG + Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990068434 5:51748080-51748102 GAGAGGATAGAGGAGAAGAGGGG + Intergenic
991248250 5:64530869-64530891 ATGGGGAAACAAGAGAAAAGGGG + Intronic
991351782 5:65726865-65726887 CAGGAAAAACAGGAGAACACAGG - Intronic
991950893 5:71945963-71945985 GAGGGGACACAGGAGAGGTGAGG + Intergenic
992376483 5:76193011-76193033 CAGTGTAAATAGGAGCAGAGGGG - Intronic
992543016 5:77783039-77783061 GACAGGAAACAGGAGAATAGGGG + Intronic
992589333 5:78277383-78277405 CAGGAAAAAAAGGAGAAGGGAGG + Intronic
992624813 5:78627357-78627379 CAGGGGAGACAGGGAAAGTGAGG - Intronic
992868633 5:80983202-80983224 CAGAGGAAACAGGGGCAAAGGGG - Intronic
993809638 5:92459393-92459415 CAGGGGAAGGAGGAGAGGAAGGG - Intergenic
993884271 5:93397886-93397908 CAGAAGAGACAGGGGAAGAGAGG + Intergenic
993991905 5:94668090-94668112 CAAGGGACAAAGGAGAAGAGAGG - Intronic
995428378 5:112048993-112049015 CAGAGGAGAGAGGAGAGGAGGGG + Intergenic
995933998 5:117486339-117486361 CAGGGCACACAGCAGAATAGAGG - Intergenic
996578353 5:125001170-125001192 CAGAGGAGACGGGAGGAGAGGGG - Intergenic
997360397 5:133291146-133291168 CAGGAGACACAGGAGGGGAGGGG + Intronic
998195239 5:140063414-140063436 CAGGAGGAAAAGGAGAAGAAAGG + Intergenic
998308939 5:141107586-141107608 GAAGGGAAGAAGGAGAAGAGGGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
999001868 5:147932526-147932548 CAGGAGATACAGCAGAGGAGAGG + Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999432390 5:151535554-151535576 CAAAGGATACAGGTGAAGAGAGG - Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000479829 5:161758377-161758399 GAGGGGAACAAAGAGAAGAGGGG + Intergenic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001604731 5:172951546-172951568 CAGAGGAACGAGGAGAAGAGAGG - Exonic
1001965967 5:175910186-175910208 CAGGGATACCAGGAGCAGAGGGG - Intergenic
1002250979 5:177929014-177929036 CAGGGATACCAGGAGCAGAGGGG + Intergenic
1002276588 5:178107953-178107975 CAGGGGAGAGAGGACAAGGGAGG + Intergenic
1002610281 5:180413298-180413320 AAAGGGAAACAAAAGAAGAGAGG - Intergenic
1002947627 6:1778404-1778426 CAGTGGAGACAGCAGACGAGTGG + Intronic
1003486555 6:6585093-6585115 GAGGGGAGAGAGGAGAGGAGAGG - Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1003666106 6:8112719-8112741 CAAGGGAGTCAGGAGGAGAGAGG + Intergenic
1004165950 6:13256489-13256511 AAGGGGAAACAGGGTAAAAGTGG - Intronic
1004591195 6:17053601-17053623 CAGGCAAAATTGGAGAAGAGGGG + Intergenic
1004653056 6:17630693-17630715 CAGAGGAGACGGGAGACGAGAGG + Intronic
1004766006 6:18727717-18727739 ATGGGGAAACAGTAGAACAGTGG - Intergenic
1005285060 6:24316345-24316367 CAGAGGACTCAGGAGAAAAGTGG + Intronic
1005490360 6:26342077-26342099 AACGGGAAGGAGGAGAAGAGTGG + Intergenic
1005712534 6:28515699-28515721 CAGGAAAAACAGGACAAGACAGG + Exonic
1006180749 6:32152077-32152099 CCGGGGTAAGAGGAGGAGAGAGG - Intronic
1006304997 6:33213514-33213536 CAGAGGAAACAGGAAGTGAGGGG - Intergenic
1006662640 6:35660999-35661021 TAGGGGAAACAGGAGGAAATGGG + Intronic
1006725596 6:36197045-36197067 GGGGGGAAACCGGAGAAGCGGGG + Intronic
1006825102 6:36928996-36929018 AAGGGGAAACAAGAGAAAACTGG - Intergenic
1007634165 6:43287913-43287935 AAGGGGGCACAGGAGAGGAGAGG + Exonic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1008464430 6:51814779-51814801 CAGGGGAGACAGGAAATGAGAGG + Intronic
1008581741 6:52914195-52914217 CAGGGGAAAACGGATCAGAGTGG - Intergenic
1009349148 6:62652786-62652808 CAGAGGAGACAGGAGAAAAGAGG - Intergenic
1009573544 6:65421777-65421799 CTGTGGAGACATGAGAAGAGGGG + Intronic
1010028509 6:71246786-71246808 GAGAGGAAACAGGAGAAAATAGG - Intergenic
1010700470 6:79038594-79038616 TAGGGGAAAAAAAAGAAGAGTGG - Intronic
1010926361 6:81751329-81751351 AAGGAGAAAGAAGAGAAGAGAGG + Intronic
1011668367 6:89658198-89658220 CAGGGGAAAGAGGTGATCAGTGG - Exonic
1011921769 6:92586503-92586525 CAGGGGAAGCAGGACATCAGAGG - Intergenic
1012658905 6:101860967-101860989 TATGGGAAAGTGGAGAAGAGAGG - Intronic
1013545118 6:111149023-111149045 CAGAGGAAACTAGAGAAGAAGGG - Intronic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1014453627 6:121611469-121611491 AGGGGGAAGCAGGAGAAGAGGGG - Intergenic
1014519694 6:122426427-122426449 CTGGGCAAAGAGGAGAATAGAGG + Intronic
1014886592 6:126789323-126789345 CTGGAAAAACAGGAAAAGAGAGG + Intergenic
1015011616 6:128356180-128356202 CTAAAGAAACAGGAGAAGAGGGG - Intronic
1015203271 6:130606048-130606070 CATGGGGAATAGGAGAAGAGTGG + Intergenic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1015550036 6:134402709-134402731 CAGGGGAAGAAGGAGAAGATAGG - Intergenic
1015572665 6:134637449-134637471 CAGGGGGAAGGAGAGAAGAGGGG + Intergenic
1015683489 6:135833907-135833929 AAGGGAAAAGAGGGGAAGAGAGG + Intergenic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016793794 6:148095770-148095792 CTGAGGAAACAGGAACAGAGTGG - Intergenic
1017597546 6:156045335-156045357 GAAGGGATAAAGGAGAAGAGAGG + Intergenic
1018765661 6:166931348-166931370 CCAGAGAAACAGGAGCAGAGAGG - Intronic
1020017395 7:4838879-4838901 CAGGGGACTGAGGAGCAGAGTGG - Intronic
1020066361 7:5190862-5190884 CAGCGGGAAGAGGAGACGAGAGG - Intronic
1020077204 7:5266270-5266292 CAGAGGAGACAGGAGCGGAGGGG + Intergenic
1020803276 7:12758215-12758237 CATGGTAAACAGGAGAAGCGTGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022257576 7:28674603-28674625 CAGAGGAATCAGGAGAACAGAGG - Intronic
1022351869 7:29573754-29573776 CAAGGGAAACAGAATCAGAGAGG - Intergenic
1022656668 7:32325518-32325540 CAGGGGAAAACGTAGAACAGAGG - Intergenic
1022802051 7:33786142-33786164 AAGGAGGAGCAGGAGAAGAGAGG + Intergenic
1023090624 7:36614579-36614601 CAGGGCAAGAAGGAGAAGACAGG - Intronic
1023303374 7:38797763-38797785 CAGGGGAAACAGGTTAACAGGGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024087040 7:45902262-45902284 AAGGGGAGAGAAGAGAAGAGGGG + Intergenic
1024197205 7:47071082-47071104 CCAGGGAAACAAGAGAGGAGAGG + Intergenic
1024199781 7:47095152-47095174 CAGCAGAAACCAGAGAAGAGAGG - Intergenic
1024306665 7:47935008-47935030 CACGAGAAACAAGAGCAGAGTGG - Intronic
1025201910 7:56967395-56967417 CAGAGGAGACAGGAGCAGAGGGG - Intergenic
1025670036 7:63609533-63609555 CAGAGGAGACAGGAGCAGAGGGG + Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025873098 7:65453344-65453366 CAGGGGAAAATGGAGTAGAAGGG + Intergenic
1026228364 7:68462663-68462685 CTGGGGAAAGAGGAGGGGAGGGG - Intergenic
1026506758 7:70991197-70991219 CAGGGGAACAAGCATAAGAGAGG - Intergenic
1026529703 7:71186242-71186264 AAGGGGAAAGGGGAGTAGAGAGG - Intronic
1026797476 7:73375714-73375736 CAGGGGAGGCAGGAGAGCAGGGG + Intergenic
1026880487 7:73904213-73904235 CAGGGGTGACAAGAGAAGACTGG - Intergenic
1027741641 7:82015109-82015131 CAGGTGAGACAGGTGAAGTGAGG - Intronic
1028428756 7:90722115-90722137 GAGGGGAGAAGGGAGAAGAGGGG - Intronic
1029189719 7:98762772-98762794 GAGGGGAAACAGGTTCAGAGAGG + Intergenic
1029276798 7:99410031-99410053 CAGAAGAAACAGGACCAGAGAGG + Exonic
1029480486 7:100809488-100809510 CAGGTGAAACTGGTGAACAGAGG - Intronic
1029731121 7:102438986-102439008 CAGGGCAGGCAGGAGCAGAGGGG - Exonic
1030379971 7:108800752-108800774 GAGGGGAAGGGGGAGAAGAGGGG - Intergenic
1030666323 7:112282586-112282608 CAGTGGATAGAGGAGAGGAGAGG - Intronic
1031501350 7:122521606-122521628 TATGGGAAACAGTAAAAGAGAGG + Intronic
1031997944 7:128245233-128245255 CAGGGGAAAGAGGGGAAGCAGGG - Intronic
1032489728 7:132315160-132315182 CCTGGGAAACAGGACCAGAGGGG + Intronic
1032567345 7:132960262-132960284 GAGAGGAGAGAGGAGAAGAGAGG + Intronic
1032853995 7:135818927-135818949 CAGAGGAAAAAGAAGAGGAGAGG - Intergenic
1032945694 7:136849748-136849770 CAGGGGAAGGAGGAGAAGACAGG + Intergenic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033561214 7:142533529-142533551 GAGGGGAAACTGAAGAACAGGGG + Intergenic
1034023318 7:147669708-147669730 AATGGGAAACAAAAGAAGAGTGG - Intronic
1034245523 7:149641426-149641448 CAGGGGCAGCAGGAGAAGCAGGG + Intergenic
1034367842 7:150567357-150567379 GTTGAGAAACAGGAGAAGAGAGG - Exonic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035097398 7:156366515-156366537 CACGGGAAACAGGAGAACCAAGG + Intergenic
1035236779 7:157502470-157502492 GAGGGGAAACAGGGAAACAGAGG + Intergenic
1035435865 7:158858852-158858874 CAGGGGAAAGGGGAGGGGAGAGG - Intronic
1035960823 8:4135393-4135415 AAGGGGAAAGAGGGAAAGAGGGG + Intronic
1035970579 8:4243413-4243435 CAGGGGAACAAGGAGCAAAGTGG - Intronic
1036244034 8:7101559-7101581 CAGGGGTAGCAGGAGGAAAGGGG - Intergenic
1036250216 8:7155725-7155747 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1036367272 8:8131725-8131747 AAGGAGAAAGAGAAGAAGAGTGG - Intergenic
1036611977 8:10358375-10358397 GGGGGGAAACAAGAGAATAGAGG - Intronic
1036883608 8:12533937-12533959 AAGGAGAAAGAGAAGAAGAGTGG + Intergenic
1036897809 8:12649868-12649890 CAGGGGTAGCAGGAGGAAAGGGG + Intergenic
1037582818 8:20255677-20255699 CGGGGGAAACTGGAGCAGAGAGG + Intronic
1037704652 8:21309112-21309134 CAGGGGCAGCAGGGGATGAGGGG - Intergenic
1037943405 8:22971819-22971841 TAGCTGAAGCAGGAGAAGAGTGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1039102904 8:33959392-33959414 CAGGGAAAAAAGGAGAAAACAGG + Intergenic
1039821702 8:41140820-41140842 GAGAGGAAGCAGGAGAGGAGAGG + Intergenic
1040034733 8:42859251-42859273 CAGGGAAAAAAGTAGAAGTGAGG + Intronic
1040694361 8:49978282-49978304 AAGGGGGAAGAGGAGAGGAGAGG + Intronic
1041367032 8:57117314-57117336 TAGGGGAAACAGGAGAGTTGGGG + Intergenic
1041375839 8:57208907-57208929 CAGGGGAGTCAGAAGATGAGCGG + Intergenic
1041376604 8:57213286-57213308 CAGGGGAGTCAGAAGATGAGCGG + Intergenic
1041377550 8:57218674-57218696 CAGGGGAGTCAGAAGATGAGCGG + Intergenic
1041758524 8:61339199-61339221 AAGAGGAAACAGGAGAAGCATGG + Intronic
1041926804 8:63245446-63245468 CAGGGGAAAGGGTAGGAGAGGGG - Intergenic
1041998881 8:64097675-64097697 CATGGGAATATGGAGAAGAGAGG + Intergenic
1041998889 8:64097726-64097748 CATGGGAATATGGAGAAGAGAGG + Intergenic
1042363556 8:67909865-67909887 GAGGGGAAAGAGGAGAGAAGGGG + Intergenic
1042473122 8:69213864-69213886 CAGAGGAAAGAAGAGAAGTGTGG - Intergenic
1043099798 8:76028939-76028961 GAAGGGAAATGGGAGAAGAGAGG - Intergenic
1043339297 8:79218202-79218224 GAGGGGAAATAGCAGAAGATTGG + Intergenic
1044256662 8:90071405-90071427 AAGGGGGAAGAGGAGAAGGGAGG + Intronic
1044524204 8:93233152-93233174 CAGGGAAAATAGGAGGCGAGGGG - Intergenic
1045011086 8:97958890-97958912 CAGGGGAAGTAGCAGAAGAGAGG - Intronic
1045592938 8:103618625-103618647 TAGAGGAATCAGAAGAAGAGGGG - Intronic
1045796707 8:106054381-106054403 CAGTAGAAAAAGCAGAAGAGAGG + Intergenic
1045806225 8:106165543-106165565 AAGAGGAAACAGGAGAGGAGGGG + Intergenic
1046204472 8:110974770-110974792 AATGGAAAACAGGAGAAGAGAGG + Intergenic
1046239893 8:111476766-111476788 CAGATGAAAGAGGAAAAGAGAGG + Intergenic
1046430113 8:114113597-114113619 CAGGGGGAAGAGTAGCAGAGCGG - Intergenic
1046820618 8:118630471-118630493 CAAGGGCAGGAGGAGAAGAGAGG - Intergenic
1047073617 8:121375686-121375708 CAGGGGAAACAAGAGTGTAGAGG + Intergenic
1047131286 8:122022772-122022794 GAGGGGAGAAAGGAGGAGAGAGG - Intergenic
1047191625 8:122683601-122683623 CCAGGGCAAGAGGAGAAGAGAGG - Intergenic
1048604798 8:135956520-135956542 CAGGGGAAACAGCACAGAAGGGG - Intergenic
1048662162 8:136617150-136617172 AAGGAGAAACAGGACAGGAGAGG - Intergenic
1049108772 8:140629876-140629898 CAGGGGGAAGAGGAGGGGAGGGG + Intronic
1049510299 8:143023944-143023966 CAGGGGAGACAGGCTCAGAGTGG + Intergenic
1049544490 8:143223436-143223458 CTGGGGAGAAAGGAGAAGAGGGG - Intergenic
1049655576 8:143795521-143795543 CTGGGGACACCTGAGAAGAGGGG + Exonic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050641580 9:7673494-7673516 GAGGGGAAAGAAAAGAAGAGTGG + Intergenic
1050740989 9:8821094-8821116 GAGGTGAAAAAGGAGAAGAAGGG - Intronic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1052003049 9:23311015-23311037 CAGAGGGAAAAGGAGAAGTGGGG + Intergenic
1052017542 9:23486657-23486679 CAGGGGATTCTGGAGAAGAAAGG + Intergenic
1052484064 9:29072977-29072999 CATGGGAGATAGGAGGAGAGAGG - Intergenic
1053002772 9:34586345-34586367 CAGGGCAGAGAAGAGAAGAGAGG + Intronic
1053085302 9:35214666-35214688 GGGGGGAAAAAGGAGAGGAGAGG + Intronic
1053437554 9:38086551-38086573 CAGGGGAGAGAAGAGAAGTGGGG + Intergenic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055786943 9:79881490-79881512 GGGAGGAAAGAGGAGAAGAGAGG - Intergenic
1056126678 9:83541484-83541506 CAGGGGACACAGTTAAAGAGAGG - Intergenic
1056578473 9:87873156-87873178 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1056637626 9:88344728-88344750 CAGGGGAAAAGGGTGAAGGGAGG - Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057842293 9:98495789-98495811 CAGGGGAAACAGGAACAAAGGGG - Intronic
1057871625 9:98722469-98722491 GTGGGGAAACAGGTGCAGAGAGG - Intergenic
1058475402 9:105327825-105327847 CAGGGAAAACAGGATTATAGAGG - Intronic
1058777313 9:108297012-108297034 CAGGGGGAGGAGGAGAAGAGGGG + Intergenic
1059432275 9:114257405-114257427 GAGGGAACACAGGAGAAGATGGG - Intronic
1060077089 9:120601600-120601622 CAGAGGAAACATGGGATGAGAGG - Exonic
1060093175 9:120762891-120762913 AAGGGGAGACAGCTGAAGAGCGG + Exonic
1060256404 9:122034864-122034886 GAGGGGACACAGGTGACGAGGGG - Intronic
1060528592 9:124334458-124334480 CAGAGGAATGAGGTGAAGAGAGG + Intronic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1060723929 9:125995263-125995285 CATGGGAGACAGCAGCAGAGGGG + Intergenic
1060985080 9:127815189-127815211 CAGGGGAGACAGGAGCCTAGCGG - Exonic
1061045810 9:128164283-128164305 CTGGGGAGACAGGCCAAGAGTGG - Intergenic
1061251195 9:129427464-129427486 CATGGGGATCTGGAGAAGAGCGG + Intergenic
1061307663 9:129741454-129741476 CTGGGGGAAAAGGAGAAGAGGGG - Intronic
1062194136 9:135263891-135263913 GAGGGGAAGGAGGAGGAGAGGGG - Intergenic
1062271911 9:135713727-135713749 CAGGAGAAGCAGGAGCTGAGGGG - Intronic
1062711160 9:137975883-137975905 TAGGAGAAGCCGGAGAAGAGGGG - Intronic
1203434441 Un_GL000195v1:124484-124506 CAGGGGGAGCAGGAAAGGAGGGG + Intergenic
1185644879 X:1609477-1609499 CAGCGGCAGCAGGAGAGGAGGGG - Intergenic
1185669755 X:1798483-1798505 GAGAGGAGAGAGGAGAAGAGAGG - Intergenic
1185669757 X:1798500-1798522 GAGAGGAGAGAGGAGAAGAGAGG - Intergenic
1185756310 X:2655760-2655782 CAGGGGACGGAGGAGAAGAGAGG + Intergenic
1186040634 X:5474051-5474073 CAAGGAAAACAGGTGATGAGGGG + Intergenic
1186396229 X:9211739-9211761 CAGGAGGAAGAGGTGAAGAGAGG - Intergenic
1186437710 X:9557371-9557393 CAGGGGAAACAGGCGGTCAGAGG + Intronic
1186443247 X:9604127-9604149 CAGGGGAATTGGGAGAAGGGTGG - Intronic
1186625528 X:11289360-11289382 CAGGGGAAATACGAGAAGTTTGG - Intronic
1187423859 X:19160092-19160114 CAGGGGAATCAGGTAATGAGGGG + Intergenic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1187942301 X:24393769-24393791 CAGAGGAAGCTGGAGAGGAGAGG + Intergenic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188491511 X:30742946-30742968 GAGGGGGAACAGGGGAAGATAGG + Intergenic
1188640100 X:32490451-32490473 CCTGGGTAACAGGAGAAGAGCGG - Intronic
1189619812 X:42824170-42824192 CAGGGTAAAGAGGAAAAGAGAGG - Intergenic
1190002726 X:46705155-46705177 CAGGGGAGAAAGGGGAAGGGTGG + Intronic
1190044390 X:47100627-47100649 CAGGGGAGAAAGGAGAAGAGAGG + Intergenic
1190598176 X:52066740-52066762 GAGGGGAAAGAGGAGAAGAGAGG + Intronic
1190610648 X:52187333-52187355 GAGGGGAAAGAGGAGAAGAGAGG - Intronic
1190650295 X:52562934-52562956 CAGGGGGATCAGGTGAAGATGGG - Intergenic
1191102608 X:56748267-56748289 CAAGGGAAACAGAATAATAGAGG + Intergenic
1191735948 X:64387814-64387836 GAGAAGAAAAAGGAGAAGAGAGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192218390 X:69179817-69179839 CAGGGGAGAGAGGAGAAGGGGGG - Intergenic
1192309939 X:70002703-70002725 TTGAGGAAACAGGACAAGAGAGG - Intronic
1192331556 X:70179471-70179493 CAGGGGAAAGAGGTCAAGAGAGG + Intronic
1192422455 X:71045703-71045725 GAGGGGAAATGGGTGAAGAGGGG - Intergenic
1193833298 X:86312899-86312921 CTGGTGAATCAGGAGAGGAGTGG + Intronic
1194279592 X:91932599-91932621 CAGAGAGAACAAGAGAAGAGAGG + Intronic
1196287132 X:113896097-113896119 CAGGGGACTCAGTAGAAGAAGGG - Intergenic
1196504617 X:116426640-116426662 AAGGAGAAACTGGATAAGAGGGG + Intergenic
1196566914 X:117217936-117217958 CAGGGGTAAAAGGAAAATAGGGG + Intergenic
1198013044 X:132579067-132579089 CAGGGGAAAAAAGAAAAGAGAGG - Intergenic
1198096437 X:133384413-133384435 AAGAGGAAAGAGGAGATGAGAGG + Intronic
1199265260 X:145820612-145820634 CAGGGGAGCTAGGAGAAAAGAGG - Exonic
1199284622 X:146042210-146042232 GAGAGGATACAGGAGAAGAGAGG + Intergenic
1200597068 Y:5156090-5156112 CAGAGAGAACAAGAGAAGAGAGG + Intronic
1200827226 Y:7657990-7658012 CAGGGAGACCAGGAGAAGAGGGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1200884194 Y:8252528-8252550 CAGGGAGAGCAGGAGAAGAGGGG + Intergenic
1200954520 Y:8930398-8930420 CAGGGAGACCAGGAGAAGAGGGG - Intergenic
1201238394 Y:11933840-11933862 CTGGAGAAACATGGGAAGAGTGG + Intergenic
1202124604 Y:21557021-21557043 CAGGAAGACCAGGAGAAGAGGGG - Intergenic
1202154404 Y:21872359-21872381 CAGGAAGACCAGGAGAAGAGGGG + Intergenic
1202195377 Y:22295060-22295082 CAGGGAGACCAGGAGAAGAGGGG + Intergenic