ID: 1164743580

View in Genome Browser
Species Human (GRCh38)
Location 19:30594748-30594770
Sequence CAAGCAGCGGCTTCTCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164743580_1164743586 8 Left 1164743580 19:30594748-30594770 CCCCTGCGAGAAGCCGCTGCTTG No data
Right 1164743586 19:30594779-30594801 ATTCCATTTAGTGACAGCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1164743580_1164743589 29 Left 1164743580 19:30594748-30594770 CCCCTGCGAGAAGCCGCTGCTTG No data
Right 1164743589 19:30594800-30594822 GGCCAACGTCTGAGCCACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164743580 Original CRISPR CAAGCAGCGGCTTCTCGCAG GGG (reversed) Intronic
No off target data available for this crispr