ID: 1164743656

View in Genome Browser
Species Human (GRCh38)
Location 19:30595093-30595115
Sequence CAGGAGAGGCACAATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164743652_1164743656 -7 Left 1164743652 19:30595077-30595099 CCAAGGAAGCCAGAGCCAGGAGA 0: 1
1: 2
2: 10
3: 191
4: 733
Right 1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 241
1164743648_1164743656 21 Left 1164743648 19:30595049-30595071 CCGCACAGAGGTAGGTCTCAAAG 0: 1
1: 0
2: 0
3: 16
4: 120
Right 1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164743656 Original CRISPR CAGGAGAGGCACAATGAAGT TGG Intronic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
903074119 1:20748854-20748876 TAGAAGAGGCACAATGTTGTAGG - Intronic
904334518 1:29787971-29787993 CAGGAGGGCCAATATGAAGTGGG - Intergenic
906724963 1:48037409-48037431 CAGGAGAGGGAGAATGAAAGGGG + Intergenic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907422090 1:54354428-54354450 CAGGAGAGACACGAGGCAGTGGG + Intronic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
909372308 1:74898084-74898106 CAGGTGAGACACAATGAGGAAGG - Intergenic
910136094 1:83971783-83971805 CAGGACAGGGAGACTGAAGTGGG - Intronic
914310542 1:146462120-146462142 TTGGAGGGGCACAAGGAAGTTGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916622660 1:166517426-166517448 CATGAAAGGCACAATGCAATAGG + Intergenic
919972088 1:202587611-202587633 CAGGAAAGGCACACTGATGGTGG + Exonic
923489320 1:234469771-234469793 TAGGAGATACACAATGAAGCTGG - Intronic
924270045 1:242322706-242322728 CAGGAGAGAAAGAGTGAAGTAGG - Intronic
924872375 1:248062577-248062599 CAGGGGAGGGACGATAAAGTGGG + Intronic
1063330682 10:5155929-5155951 GAGAAGAGGCAGAATGAAGGTGG - Intergenic
1064731377 10:18334402-18334424 CTGGAGAGGCAAAATGCAGGAGG - Intronic
1065035277 10:21631657-21631679 CAGGAGAGAGAAAATGAAGAGGG + Intronic
1065938197 10:30540198-30540220 CAGTAGAGGAACATTGAATTTGG - Intergenic
1066228871 10:33412387-33412409 CAGGAGAGTCACAGAGAGGTTGG + Intergenic
1066714863 10:38276057-38276079 CAGGAGAGAGAGAGTGAAGTAGG + Intergenic
1066783215 10:38974642-38974664 CAGGAGAGAGAGAGTGAAGTAGG - Intergenic
1067661774 10:48241441-48241463 CAGGAATGGCACCATGGAGTTGG - Intronic
1067820896 10:49529152-49529174 CTGGGGAGGCCCAATGAACTGGG + Intronic
1068111400 10:52684803-52684825 CAGGATAAGAACAATGCAGTAGG - Intergenic
1069828068 10:71266336-71266358 CAGGAGGGGCACCAGGAAGCGGG - Intronic
1069915464 10:71784253-71784275 CAGGAGAGGCCCAAGTTAGTCGG - Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1074667296 10:115742948-115742970 CAGGAAAGTTACAATGAAGGAGG + Intronic
1076198507 10:128539334-128539356 CAAAATAGGCATAATGAAGTGGG - Intergenic
1079184425 11:18223367-18223389 CAGGACAGGAACAGTGTAGTTGG + Intronic
1081000578 11:37665399-37665421 CAGGAGAGGGAAAAAGAAGGGGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083139769 11:60712322-60712344 CCTGAGAGGCACAATCTAGTAGG - Intronic
1084276377 11:68053177-68053199 CAGGAGAGGCCCAAAGAGCTAGG + Exonic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1085129770 11:74028356-74028378 CTGGGGAGGCAAAAAGAAGTTGG + Exonic
1085384725 11:76150411-76150433 CAGAAGGGGCACCATGAAGGTGG + Intergenic
1086809969 11:91297347-91297369 AAGAAGAGTCACAATGAATTAGG + Intergenic
1086959340 11:92966867-92966889 CAAGATAGGCACAAAGAATTGGG - Intergenic
1087131178 11:94670681-94670703 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1087748970 11:101984797-101984819 CAGCTGAGGCACAAGGAAGTGGG - Intronic
1089270194 11:117296705-117296727 CAGGAGAGACAGGGTGAAGTGGG - Intronic
1089396295 11:118138076-118138098 GAGGAGGGACACACTGAAGTTGG - Intronic
1090401621 11:126452980-126453002 CAGGAGAGGCACGAAGAGGGTGG - Intronic
1090867399 11:130713735-130713757 CAGGTGAGGGACAAAGGAGTAGG - Intronic
1092064700 12:5580092-5580114 CAGGAAAGTTACAATGTAGTAGG + Intronic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092908451 12:13123740-13123762 CAGGAGAGGCGCAGTGAAGGAGG - Intronic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1102858579 12:116316102-116316124 CAGCAGAGACACCAGGAAGTTGG - Intergenic
1103197133 12:119054407-119054429 CAGTTGAGGCACAGGGAAGTAGG + Intronic
1104231771 12:126891958-126891980 AAGGAGAGGGACTATGAAATGGG - Intergenic
1105323578 13:19349851-19349873 CGGCAGAGGCAGAAAGAAGTGGG - Intergenic
1105607009 13:21934341-21934363 CAGGAGATGCACAACGCTGTAGG - Intergenic
1105870373 13:24499649-24499671 CGGCAGAGGCAGAAAGAAGTGGG + Intronic
1106664956 13:31842090-31842112 TAGTTGAGGCACAAGGAAGTAGG + Intergenic
1106753482 13:32797820-32797842 CAGGAAAGCCTCAATGAAGCTGG + Intergenic
1109734564 13:66465606-66465628 CAGAAGATGAACAATGAACTAGG + Intronic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110367291 13:74701269-74701291 CAGGTGAGACACAATGAATGAGG + Intergenic
1111082020 13:83322963-83322985 CAGAAGAGACACAAAGATGTGGG - Intergenic
1112509185 13:99993616-99993638 TAGGAGGGGAAAAATGAAGTAGG - Intergenic
1116602283 14:46941018-46941040 CTGGAGAGGCACAGTGATGCAGG - Intronic
1117959698 14:61150510-61150532 CAGATGAGGCTCAAGGAAGTTGG + Intergenic
1118078603 14:62330565-62330587 CAGGGAAGGCAAAATGAAGGAGG + Intergenic
1118903445 14:70005443-70005465 CAGGAGAGGAAAAAAGAGGTTGG - Intronic
1121002083 14:90458724-90458746 TTGCAGAGGCACAATGAAATAGG - Intergenic
1121050991 14:90818806-90818828 CTGGAGAGGCAGACTGGAGTTGG - Intergenic
1127256382 15:57297161-57297183 CAGGGAAGGCACAATTAAGCAGG + Intronic
1127831235 15:62753382-62753404 CAGGAGAGGCACAAAACAGTGGG - Intronic
1128231527 15:66038862-66038884 CAGGAGGGGAAAAAAGAAGTGGG + Intronic
1129653457 15:77507525-77507547 CAGTAGAGGGACAAGGAAGTGGG + Intergenic
1131377063 15:91934220-91934242 CAGGAGAGGAATACTGAATTGGG + Intronic
1132723830 16:1330305-1330327 CAGGGCAGGGACAAAGAAGTGGG - Intergenic
1133106841 16:3516918-3516940 CAGGAGAAGCCCACTTAAGTTGG - Intronic
1133928619 16:10213921-10213943 CAGGAGAGGCAGGATCAAGTCGG - Intergenic
1134763402 16:16734164-16734186 AGGGAGAGGGACATTGAAGTGGG + Intergenic
1134982650 16:18624993-18625015 AGGGAGAGGGACATTGAAGTGGG - Intergenic
1136544354 16:30947449-30947471 CAGGGGATGGACAATGAAGCAGG - Exonic
1137796218 16:51222374-51222396 CAAGAGAGGCACAATCACCTGGG - Intergenic
1138514684 16:57529442-57529464 CAGGAGAGTCCCAATGAGGCAGG + Intronic
1139934007 16:70554458-70554480 CACGAAAGACACAATGATGTAGG - Exonic
1142074321 16:88108621-88108643 CAGGGAAGTCACACTGAAGTGGG - Intronic
1142331015 16:89453913-89453935 CAGTTGAGGCACAAGGAAGTTGG - Intronic
1145112527 17:20176400-20176422 AAGGAGAGGGACACGGAAGTAGG - Intronic
1146174011 17:30653363-30653385 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1146347466 17:32069390-32069412 GAGGAGAGGCAGAAGGAAATAGG - Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1148566857 17:48638014-48638036 CTGTAGAGGCAGAATAAAGTCGG + Intergenic
1149134196 17:53345159-53345181 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1149253058 17:54792461-54792483 CAGAAGTGGCACACTGAACTAGG + Intergenic
1149370765 17:55991701-55991723 CAGGAGAGACACAATCTGGTAGG + Intergenic
1150004238 17:61459980-61460002 CAGTAGAGGCACACAGAATTTGG - Intronic
1150530723 17:65978381-65978403 CAGGAAAAGAGCAATGAAGTAGG + Intronic
1150700351 17:67441802-67441824 CAAGAGAGGCTGTATGAAGTAGG + Intronic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1151875345 17:76864958-76864980 CAGGAGAGAAACAGTGAAGAGGG + Intergenic
1152016709 17:77755814-77755836 CAGGAGAGGAGCTATGAGGTTGG + Intergenic
1152177377 17:78796711-78796733 CAGCAGAGCCACACTGAAGGAGG + Exonic
1153109146 18:1562733-1562755 CAGGAGAGGAACCCTGAGGTTGG - Intergenic
1153525034 18:5986786-5986808 CAGCAAAGGCACAGTGTAGTTGG - Intronic
1156389527 18:36637562-36637584 CATGGGAGGCACAAGGAAATAGG - Intronic
1156558202 18:38091252-38091274 GAGGAGAGGTACAATGTACTGGG + Intergenic
1160209658 18:76866351-76866373 CAGCAGAGGCACACTGCATTAGG + Intronic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165605197 19:37096682-37096704 CAGGGGTGCTACAATGAAGTAGG - Intronic
1166356166 19:42228895-42228917 CAGGGCAGGCAGAATGCAGTTGG + Intergenic
1167848577 19:52184517-52184539 CAGTGGAGGGACAATGAAATAGG + Intergenic
926590071 2:14731175-14731197 CAAGAGAGGCAGAATGGAGCCGG + Intergenic
926949137 2:18222346-18222368 CAGAAGAGGCATCTTGAAGTTGG - Intronic
927098123 2:19763636-19763658 CAGGAGGGGCTCAGGGAAGTGGG + Intergenic
927317859 2:21706547-21706569 CAGGAAAGGCACAGGGAACTAGG - Intergenic
927586713 2:24314078-24314100 CAGGAGAGGAACACTGAATTTGG - Intronic
927696373 2:25242281-25242303 CGGGGGAAGCACAATGAAGGAGG - Intronic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
930189090 2:48440196-48440218 TAGGAGTGGGAGAATGAAGTGGG + Intergenic
931917984 2:66979996-66980018 GAGGACAGGCATAATGAAGGTGG - Intergenic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933743625 2:85554006-85554028 CAGGGCAGTCACTATGAAGTAGG - Intronic
936781282 2:116035953-116035975 GAGGAAAGGTACAATAAAGTAGG + Intergenic
938982061 2:136536398-136536420 CAGGAGAGTCAGTACGAAGTGGG + Intergenic
938982549 2:136540275-136540297 CAGGAGAGAGAGCATGAAGTGGG - Intergenic
939831571 2:147078805-147078827 GTGGAGAGGGAAAATGAAGTTGG + Intergenic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
941341884 2:164316059-164316081 CTGTAGGGGCACAATAAAGTAGG + Intergenic
941875426 2:170427634-170427656 AAGGAGAGGCATACTGAAATAGG - Intronic
941875725 2:170430847-170430869 CAAGGGTGGGACAATGAAGTAGG + Intronic
942854080 2:180525228-180525250 CAAGATAGGTACACTGAAGTTGG + Intergenic
945131139 2:206573844-206573866 CAGTAGAGGGACCAGGAAGTGGG + Intronic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947116025 2:226771404-226771426 GAGGAGAGGAACAAAGGAGTAGG + Intronic
947764121 2:232624909-232624931 CAGGAGGGGCATCATGGAGTCGG - Intronic
1168861125 20:1046676-1046698 CAGGAGGGACACACAGAAGTCGG + Intergenic
1169804210 20:9542643-9542665 GAGGGGAGGCTCATTGAAGTAGG + Exonic
1170025041 20:11879752-11879774 CAGGAGAAGCCCAATGGATTTGG - Intergenic
1170813518 20:19693967-19693989 GAGGAAAGGCACAAAGAATTGGG + Intronic
1173616473 20:44406526-44406548 CAGGAGAGGCCCCATGGAATGGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175303145 20:57957113-57957135 CAGGAGAGACACTAAGGAGTTGG + Intergenic
1175308573 20:57995127-57995149 AAGGTGAGGCACAAAGAGGTTGG - Intergenic
1175452959 20:59085541-59085563 CAGCAGAGACGCAATGATGTTGG - Intergenic
1177225393 21:18245968-18245990 CAGTAGGTGCACAATTAAGTCGG + Intronic
1178159713 21:29897795-29897817 CAGAACAGCTACAATGAAGTGGG - Intronic
1181769812 22:25117255-25117277 CAGGAGAGGCTCATGGATGTGGG - Intronic
1181926658 22:26365159-26365181 CAGGCAAGGTAGAATGAAGTTGG - Intronic
1183144709 22:35979515-35979537 CAGAAAAGGCACAATGAAAAAGG + Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949857526 3:8475524-8475546 TAACAGAGGTACAATGAAGTTGG - Intergenic
950000952 3:9655831-9655853 CAGCAGAGGAACAATCCAGTAGG + Intronic
950004542 3:9683295-9683317 CAGTTGAGGCAGAATGAACTGGG - Intronic
950499935 3:13357395-13357417 CAGGAGATGCACAAATAAGATGG - Intronic
950701613 3:14754168-14754190 CAGAAGAGGCACAGATAAGTAGG - Intronic
951507783 3:23467887-23467909 CAGGAGAGAGACAGTGAAGTGGG + Intronic
951587276 3:24228284-24228306 AAGGAGAGGCAGAATGACCTTGG - Intronic
952624295 3:35385349-35385371 CAAGAGGGGTACAATGAAGATGG + Intergenic
952867706 3:37865670-37865692 CAGGAGAATCACTATGATGTTGG - Intronic
953839016 3:46373651-46373673 CAGGAGAAGGACAATGTTGTAGG - Exonic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
955392336 3:58530798-58530820 CAGGAGAGGCACTGTGAAGCAGG - Intronic
955426030 3:58790833-58790855 CAGGAATGGCAAAATGGAGTTGG + Intronic
955966220 3:64391893-64391915 AAGGAGAGACACTAAGAAGTAGG - Intronic
956554067 3:70498247-70498269 CAGGAAAGGCCCACTGAAGTGGG - Intergenic
959511034 3:107212431-107212453 CAGGTGAGGGACAATGAAGGAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959604647 3:108228902-108228924 CATGAAAGGCACTATGAAGTTGG + Intergenic
960216950 3:115051905-115051927 CAGGAGAGAGAAAATGAAGAGGG + Intronic
960621801 3:119644348-119644370 CAGGAGATGCTCAATGAATGAGG - Intronic
962333991 3:134509268-134509290 CAGGAGAGAGAGAGTGAAGTGGG + Intronic
962953606 3:140243994-140244016 CAGGAGAGGGACCATGGAATGGG - Intronic
964804742 3:160596348-160596370 CAGGATAGGAACAATGAGGAAGG + Intergenic
965511953 3:169577765-169577787 CAGAAGATGTACAATGAAATAGG - Intronic
965865209 3:173197330-173197352 CAGGAGAGAGAGAATGAAGGAGG + Intergenic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
970533611 4:17006801-17006823 CTATAGAGTCACAATGAAGTTGG + Intergenic
971144852 4:23965485-23965507 ACGGAGAGGCACAATGAATAAGG - Intergenic
971216505 4:24666742-24666764 AAGGAGATGCACAAGGTAGTAGG - Intergenic
971819991 4:31539440-31539462 CAGGAGAGGCAGGAGTAAGTAGG + Intergenic
973331556 4:48914755-48914777 CCTGAGAGGCACTATCAAGTGGG - Intergenic
974608620 4:64185366-64185388 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
976090029 4:81447559-81447581 CAGGAGAGGCTCAATTATATTGG - Exonic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977806528 4:101305953-101305975 CTGGAAAGGTACAGTGAAGTAGG + Intronic
978388902 4:108203792-108203814 CTGGAAAGGCACATTGAAGCAGG + Intergenic
979301812 4:119095242-119095264 GAGGAGAGGAGCAATGAAGCAGG - Intergenic
979945223 4:126821986-126822008 CAGGAGAGGCTGAATAAACTCGG + Intergenic
980189885 4:129510766-129510788 CTGGAAAGGTACAATGAAGTGGG + Intergenic
982308899 4:153963284-153963306 AAGGAGAGGAACAATGAAAGAGG - Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
985780910 5:1871389-1871411 AGGGAGAGGCACAGTGGAGTGGG - Intergenic
986728697 5:10619041-10619063 CAGGAGAGTCGCAATGCACTTGG - Intronic
986737086 5:10675853-10675875 CAGGAAAGTCACACTGAGGTTGG - Intergenic
987671882 5:21020700-21020722 CAGGAGAGACAAAATAAATTTGG - Intergenic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
993996456 5:94729325-94729347 CAGGAGTGGCACCATGGAGCGGG + Intronic
994352887 5:98767654-98767676 CAGGAGAGGGACGAAGAACTGGG + Intergenic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996259134 5:121444436-121444458 CAAAAGAGGCACCATGAATTGGG + Intergenic
999799193 5:155017548-155017570 AAGAAGAGGCCCACTGAAGTTGG + Exonic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1000397901 5:160795491-160795513 CAGGATAGTCACAATGAATAGGG + Intronic
1003219288 6:4143420-4143442 CAGGAGAGAGAGAATGAAGGGGG + Intergenic
1004748948 6:18541049-18541071 CAGGAAAGGCTTAATGGAGTAGG + Intergenic
1005882414 6:30071433-30071455 GAGGAGAGCCACTATGCAGTGGG - Exonic
1007728954 6:43934133-43934155 CAGCAGAGGCACAAGGAACTGGG - Intergenic
1008465755 6:51828960-51828982 CAGGAGAGGGACAATGAGCAAGG + Intronic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008941842 6:57055895-57055917 CAGCAGATGCAAAATGAATTGGG + Intergenic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009822889 6:68827317-68827339 CAGGAAAGGCTCAATGGAGTAGG + Intronic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1011696564 6:89918337-89918359 CTGGAGAGGCCCCTTGAAGTGGG - Intergenic
1013020489 6:106211275-106211297 CAGTAGATGCACAATGCACTGGG + Intronic
1013586149 6:111580959-111580981 CAGGAGAGGACCAAGGGAGTTGG - Intronic
1014879806 6:126709733-126709755 CAGGATAGGCACAATCTAATCGG - Intergenic
1015218287 6:130775528-130775550 CAGGAGAGGAACTCTGAACTTGG - Intergenic
1019653419 7:2173099-2173121 CAGGAGATGCAGAGTGGAGTTGG - Intronic
1022059880 7:26782998-26783020 CAGGAGAGGCAGAAAGAATCTGG - Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031972355 7:128073976-128073998 CAGGAGAGGCAGAAAGACGCGGG - Intronic
1033423067 7:141219669-141219691 GAGGACAGGCACAAGGCAGTGGG - Intronic
1033678246 7:143566201-143566223 TAGGAGAGGGACAATGAACTTGG + Intergenic
1033691051 7:143737601-143737623 TAGGAGAGGGACAATGAACTTGG - Intergenic
1033693595 7:143763245-143763267 TAGGAGAGGGACAATGAACTTGG - Intergenic
1033890757 7:146010385-146010407 CAAGAGAGGCATAATGAAAATGG - Intergenic
1034052447 7:147997580-147997602 CAAGAGACGCACAGTGAAGCGGG + Intronic
1037770017 8:21793088-21793110 CAGGAAAGGAACAATCCAGTGGG + Intronic
1037933072 8:22895317-22895339 CTGGAGAGGCATAATAATGTTGG + Intronic
1038874225 8:31529997-31530019 CAGGAGAGGAAGAATAAATTTGG - Intergenic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1042194695 8:66222132-66222154 TAGGAGGGGCTCAATGTAGTTGG + Intergenic
1043166221 8:76906076-76906098 CAGGTGATGGACAAGGAAGTGGG - Intergenic
1044537209 8:93370968-93370990 AAGGAGAGGCACAAACAAGAAGG + Intergenic
1044759397 8:95501944-95501966 CAGGATACGTACAATGTAGTAGG + Intergenic
1044819806 8:96148222-96148244 CAGGTGAGGCCCCTTGAAGTAGG - Intronic
1045135358 8:99211156-99211178 AATGAGAGGCTGAATGAAGTAGG + Intronic
1045169124 8:99644074-99644096 CAGGAGAGGCAGAGGAAAGTAGG + Intronic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046268013 8:111857600-111857622 CAGGAGAGAGAGAGTGAAGTGGG - Intergenic
1048881646 8:138876996-138877018 CAGGACAGGAAGGATGAAGTGGG - Intronic
1049899828 9:148799-148821 CAGGAGAGTGAAAATGAAGAGGG + Intronic
1050199461 9:3128248-3128270 CAGGAAAGGAATAATGGAGTAGG - Intergenic
1051366846 9:16327398-16327420 CAGGTGAGGCTCAAGGAACTTGG - Intergenic
1053168243 9:35859742-35859764 CATGAGAGGCACAAAGGAGGAGG + Intergenic
1056494478 9:87142239-87142261 CAGGAGATGCTCAATGAACATGG - Intergenic
1056862511 9:90199158-90199180 AAGAAGAGGCTCACTGAAGTGGG - Intergenic
1057490948 9:95518964-95518986 CAGGAGTGGCATAATGAGGCAGG + Intergenic
1057928481 9:99172933-99172955 CAGGAGAGGCCAAACGGAGTAGG + Intergenic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1061201168 9:129139327-129139349 CAGGAGAGGCACACTGAACTTGG + Intronic
1061291301 9:129651642-129651664 CAAGAGAGGAAGACTGAAGTCGG - Intergenic
1062001880 9:134220219-134220241 CAGGAGAGGCCCAGGGATGTTGG - Intergenic
1062176783 9:135167779-135167801 CCGGTGAGGGACAAGGAAGTGGG - Intergenic
1186452883 X:9687920-9687942 CAGGAGAAGCGCAGGGAAGTGGG - Intronic
1190072072 X:47287804-47287826 CAGGTGAGGCAAAGGGAAGTGGG + Intergenic
1192176000 X:68885924-68885946 CAGGAGAGACACAAGAGAGTAGG - Intergenic
1192357805 X:70420249-70420271 AAGAAGAGGCCCACTGAAGTTGG + Exonic
1194012146 X:88575492-88575514 CGGGAGAGGCAAATTGAATTAGG - Intergenic
1194426816 X:93748946-93748968 AAGGAGAGGCTAAAGGAAGTAGG + Intergenic
1195521970 X:105841400-105841422 AAAGAGAGGGAAAATGAAGTGGG + Intronic
1197366644 X:125572132-125572154 CAGGAAAGGGAGAATGAAGGGGG + Intergenic
1201909424 Y:19119322-19119344 CACCAGAGGCAGAATGAAGCTGG - Intergenic