ID: 1164744004

View in Genome Browser
Species Human (GRCh38)
Location 19:30598121-30598143
Sequence CTTCTTGACTTGAAGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164744000_1164744004 1 Left 1164744000 19:30598097-30598119 CCAGCTGCTGAAATATCCCGCCA 0: 1
1: 0
2: 2
3: 5
4: 416
Right 1164744004 19:30598121-30598143 CTTCTTGACTTGAAGAATAAAGG 0: 1
1: 0
2: 0
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164744004 Original CRISPR CTTCTTGACTTGAAGAATAA AGG Intronic
900701386 1:4050609-4050631 CTTCCTGACTTTAAAAATAAGGG - Intergenic
903679704 1:25088773-25088795 TTTGTTGACTAAAAGAATAAAGG - Intergenic
903694968 1:25199825-25199847 AGTCTTGACTTTAAGAATTAAGG + Intergenic
904902160 1:33865958-33865980 CTTCTTGACATCAAAAATACTGG + Intronic
906624402 1:47313368-47313390 CTTCTTTACATACAGAATAAAGG + Intronic
907784825 1:57601272-57601294 CTTCTTTATTTGAAAAATAGGGG + Intronic
908324298 1:63008313-63008335 TTTCTTGAATTGAAGAAGGAAGG + Intergenic
908476316 1:64492291-64492313 CTTTGTTGCTTGAAGAATAACGG + Intronic
909321479 1:74292643-74292665 CATATTCACTTCAAGAATAAAGG - Intronic
910575020 1:88751986-88752008 GTTCTGGACTTGGAGTATAATGG + Intronic
910685718 1:89914212-89914234 CTTACTGACTTCAAGAATGAAGG + Intronic
910921210 1:92349546-92349568 CTTATTTCCTTTAAGAATAAAGG - Intronic
915857159 1:159401042-159401064 CTTCTTGAAACAAAGAATAATGG + Intergenic
916187060 1:162143911-162143933 GTTCTTCATGTGAAGAATAAGGG + Intronic
916650257 1:166828625-166828647 CTCCATGACTTGAAGAAGCATGG - Intergenic
918316287 1:183325175-183325197 CTTTTTGACTTGGAGAATCCAGG - Intronic
918553396 1:185770495-185770517 TTTCTTGTCCTGAAGAAAAATGG + Intronic
920517914 1:206600126-206600148 CTTTTTGACTCCAAGTATAAGGG - Intronic
921482733 1:215681498-215681520 CTTCTTTCCTTGATGAACAAGGG + Intronic
923122956 1:231010547-231010569 CTTCTTCCCTTGGAGAAAAAAGG - Intergenic
923397926 1:233585479-233585501 ATTCTGGATTTGAATAATAATGG + Intergenic
1063274928 10:4555571-4555593 TTTCTTTACTGGAAAAATAATGG - Intergenic
1064983816 10:21190023-21190045 CTTCTTGCCCTGAAGCAAAAAGG - Intergenic
1066561608 10:36675824-36675846 TCTCTTGACTTGCAGAAAAATGG - Intergenic
1067815348 10:49471437-49471459 CTCCTTGACTTGAATACCAAGGG + Intronic
1068473501 10:57495500-57495522 CTTCTACACATGAAGACTAAAGG - Intergenic
1069316974 10:67117193-67117215 CTTCTTTATCTGAAAAATAAGGG + Intronic
1071041531 10:81314999-81315021 CTTTTTGACTTGATGATTTATGG + Intergenic
1071371819 10:84959090-84959112 CTTCATGACATGAAACATAAAGG - Intergenic
1074198350 10:111208720-111208742 CCTCTTGGCTTGAAGCATCAAGG + Intergenic
1076225878 10:128774923-128774945 ATTCTTGTCTTGGAGAAAAAAGG - Intergenic
1076498680 10:130917047-130917069 ATTCTGGGCTTGAAGACTAAAGG + Intergenic
1077731839 11:4739473-4739495 CTTCTTGACCTCAAGAAGATGGG + Intronic
1077869248 11:6247935-6247957 TTTGTTGACTTGAAGATGAAGGG - Intergenic
1078290203 11:10002872-10002894 TTACCTGATTTGAAGAATAAAGG - Intronic
1078970374 11:16403332-16403354 GTTGTGGACTTGAAAAATAAAGG + Intronic
1079088269 11:17462607-17462629 GTTCTTGCCTTCATGAATAATGG - Intronic
1079309695 11:19354125-19354147 CTTCTTGAATAGATGAATACTGG - Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1079774057 11:24500936-24500958 CAACTTGATTTGTAGAATAAAGG + Intronic
1080073445 11:28117774-28117796 CTTTATTACTTGAAGATTAAGGG - Intronic
1080901025 11:36491150-36491172 ATTCTTGACTTTAAAAAAAATGG - Intronic
1085353663 11:75816433-75816455 CTTCTTGGCAGGAGGAATAAAGG - Intronic
1086081377 11:82906022-82906044 CTGCTTGACTTGCAGTATAGTGG - Intronic
1088324823 11:108591076-108591098 CCTCTTGACTAGAACAATAAGGG - Intronic
1088390569 11:109310036-109310058 CTAGGTGACTTGGAGAATAATGG - Intergenic
1090555941 11:127875885-127875907 CTTCCTTACTTGAAGAAGGAGGG + Intergenic
1090562977 11:127953126-127953148 CTTTTTGACTTTAAGAAAAGAGG - Intergenic
1092687970 12:11072435-11072457 CTTCCTGACCTGCAGAGTAAGGG + Intronic
1094525136 12:31226469-31226491 CTTCTTGACCCTAAGAAGAAGGG - Intergenic
1094528568 12:31250409-31250431 TTTCTTGACCTGCAAAATAAGGG + Intergenic
1095200930 12:39383183-39383205 CTTCTTGAATTGAAGGTCAAAGG + Intronic
1095594943 12:43948576-43948598 CTTGGTGACTTAAAGAATAAAGG - Intronic
1097732191 12:63141169-63141191 CTACTTTACTTGAAAATTAAAGG + Intergenic
1099445409 12:82745862-82745884 CTTCTTGAATTTAAGAAAAAGGG - Intronic
1099549929 12:84031225-84031247 TTTCTTCACCTGAAGAATAGAGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101848443 12:108382663-108382685 CTTCTAGACTTAAAGAATCCAGG + Intergenic
1102677326 12:114667637-114667659 CTTCGTGACTTGTAGATTTAAGG - Intergenic
1103168075 12:118787940-118787962 CTTCTTAGCTTCAAAAATAATGG - Intergenic
1103645690 12:122390729-122390751 GTTCTTGACTTGAAAAAAAATGG - Intronic
1104201583 12:126595184-126595206 CTTTTTGATTTGATGAACAAAGG - Intergenic
1104724728 12:131068768-131068790 CTTCATGACAAGAAGAACAAAGG + Intronic
1107067267 13:36228095-36228117 CTTCTTGACTATTTGAATAATGG + Intronic
1107330250 13:39292030-39292052 CTCATAGACTTGAAGAACAAAGG + Intergenic
1108942293 13:55971815-55971837 CTTATTAACTTAAAAAATAAAGG - Intergenic
1109158786 13:58946163-58946185 CATCTTCACATGAAGAAAAAAGG + Intergenic
1114233246 14:20802486-20802508 CTTGTTGTCTTGGAGCATAAGGG + Intronic
1114729839 14:24980777-24980799 CTTCTAAACATGAAAAATAATGG + Intronic
1116221536 14:42094880-42094902 ATCCTTGACTTCCAGAATAATGG - Intergenic
1116417171 14:44692820-44692842 CATCTTGACATGAACCATAAAGG - Intergenic
1117419125 14:55526143-55526165 CTTCTTCATTTTAAGAACAAAGG - Intergenic
1118788996 14:69071669-69071691 CTTTTTGACTTAAATAATCATGG - Intronic
1118995984 14:70836490-70836512 CTTGTTCACTTGGAGAATGATGG + Intergenic
1124881633 15:33648313-33648335 TTTCTTGACTGGAAGAAAAAAGG - Intronic
1125124894 15:36208644-36208666 TTTCTTCACTTGTAGAATCAGGG + Intergenic
1125497594 15:40211733-40211755 CTTCTGGACTTCGAGAATAGGGG + Intronic
1127453398 15:59137569-59137591 CTTTTTGATTTAAAGAACAAAGG - Intronic
1129284257 15:74511346-74511368 CTTTGTCACTTGAAGAATACAGG + Intergenic
1133566203 16:6996097-6996119 GTTCTTGACATGAAAACTAATGG - Intronic
1133698249 16:8285501-8285523 TTTCTTCACTTGAAAAATCATGG + Intergenic
1137818075 16:51418443-51418465 CAACTTGAATGGAAGAATAAAGG + Intergenic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1138895751 16:61202140-61202162 ATTCTTGACTTGAAGAACACTGG + Intergenic
1139388735 16:66591730-66591752 ATTCATGATTTGAAAAATAAAGG + Intergenic
1144092264 17:11868751-11868773 CTGCTTGAGTTGGAGAAAAATGG - Intronic
1144528085 17:16008249-16008271 CATCTTGACTTGAAGTCTAATGG + Intronic
1149802012 17:59578285-59578307 CTTCGTTACTTTAAAAATAATGG + Intronic
1149844478 17:59997200-59997222 CTTCGTTACTTTAAAAATAATGG - Intergenic
1150328004 17:64272331-64272353 CTTCTTGACTTTAGGAATCCAGG + Intergenic
1157038440 18:44007001-44007023 CTTCTTGACTAGAGGAGAAATGG - Intergenic
1157080068 18:44514782-44514804 TTTCTTGACTAGCAGAAAAAGGG - Intergenic
1158298441 18:56025463-56025485 CTCCTTTAATAGAAGAATAACGG - Intergenic
1158925433 18:62252926-62252948 CTTGTTGACTGAATGAATAAAGG - Intronic
1159158340 18:64611351-64611373 CTTCGAGACCTGAAAAATAAAGG + Intergenic
1160066049 18:75575311-75575333 TTTCTTGATCTGAAGAGTAAGGG + Intergenic
1160091334 18:75829877-75829899 CTGCATGACTTTAAGGATAAAGG - Intergenic
1160122237 18:76140990-76141012 CTTCCTGATTTGAAGGACAATGG + Intergenic
1164744004 19:30598121-30598143 CTTCTTGACTTGAAGAATAAAGG + Intronic
1166095124 19:40533606-40533628 CTTCTTGACTTTGAGTTTAATGG + Intronic
925642259 2:5996941-5996963 CTTCTTGTCTTGGAGAAAGAGGG + Intergenic
926315310 2:11705300-11705322 CTTGTTGAATGGAAAAATAAAGG - Intronic
926994742 2:18722351-18722373 CTTCATGTCTTCATGAATAAAGG + Intergenic
927051206 2:19331089-19331111 CTTCTGGACCAGAAGAATCAAGG - Intergenic
928635276 2:33239394-33239416 CTTCCTGAGTTAAAGAATGAAGG - Intronic
928844027 2:35646825-35646847 CATGTTTACTTGAAGAACAAGGG + Intergenic
929223021 2:39484864-39484886 TTTCTTCATTTGAAAAATAAAGG - Intergenic
929718022 2:44333273-44333295 GTTCTTAACTTTAAGAAAAAAGG + Intronic
930447396 2:51491077-51491099 GTTCTTAACTAGAAGAATTATGG - Intergenic
931074987 2:58700834-58700856 TTTCTTCACTTGAATAATGAGGG - Intergenic
931167160 2:59760661-59760683 CTTTTAGACTAAAAGAATAAAGG + Intergenic
933335230 2:80949598-80949620 GTTGTTGACTTTGAGAATAAAGG - Intergenic
935384883 2:102489490-102489512 CTTCTGAACTTGAAGAAAGATGG - Intronic
935393796 2:102584133-102584155 CATTTTGACTAGAAGAATTAGGG - Intergenic
935862911 2:107353124-107353146 ATTCTTGGCTTGAACATTAATGG - Intergenic
936631487 2:114207864-114207886 CTTGCTGACTTTAAGAATGAAGG - Intergenic
937266739 2:120621075-120621097 CTCTTTGATTTGTAGAATAATGG - Intergenic
937784560 2:125880027-125880049 GTTCTTGAGTTGAAGAACCAAGG - Intergenic
938680333 2:133683370-133683392 CTTCTAAAGGTGAAGAATAAAGG - Intergenic
939018547 2:136931038-136931060 CCTCGTGACTAGAAGAAAAATGG - Intronic
939276192 2:139999605-139999627 GATATTGACTTGAAGAAAAAGGG + Intergenic
939300100 2:140325542-140325564 CATCTTGACTTGAACAAACATGG - Intronic
939447460 2:142328747-142328769 CTTCTTGGCTTCAAGATTAGAGG - Intergenic
939551906 2:143626335-143626357 CTTGTTGCCTTGAACAATGAAGG - Intronic
939713464 2:145553423-145553445 CATCTTGACTCTAAGAGTAATGG + Intergenic
940006369 2:149012534-149012556 CTTCTTGCCTTGATGCAGAAAGG - Intronic
943038866 2:182780139-182780161 CTTCTTCACTAGAAGAATTTGGG - Exonic
943431415 2:187807051-187807073 TTTTTTGACATGAAAAATAAGGG + Intergenic
943454357 2:188085129-188085151 TTTTATGACTTGAGGAATAAGGG + Intergenic
943679954 2:190758026-190758048 CTTCTTAACTGTAAGAAAAATGG - Intergenic
944178148 2:196856769-196856791 CTTTTTTACTTGAAGGATAATGG + Intronic
946776683 2:223149586-223149608 CTTATTGGCTTAAATAATAAAGG - Intronic
947271384 2:228339711-228339733 CTTCTTGACTGGAATAATGAGGG - Intergenic
947984621 2:234437771-234437793 CTTCTTGGGTTGAAGAAGAGAGG + Intergenic
1169827753 20:9788747-9788769 CTTCTTGTCTTGGATAACAAAGG + Intronic
1170464013 20:16606466-16606488 CTTGTTGACTTGAAGGCCAAAGG - Intergenic
1171048825 20:21836860-21836882 CCTCTTGCCTTGAGGAATATTGG - Intergenic
1174255337 20:49250436-49250458 CTTCTGGACAATAAGAATAATGG - Intronic
1178328619 21:31665886-31665908 CTTCTTCACTGTAAAAATAAGGG - Intronic
1180113803 21:45682513-45682535 CTTATCCACGTGAAGAATAATGG + Intronic
949424859 3:3906133-3906155 ATTCTTGAGCTGAAGAAAAATGG + Intronic
949665683 3:6336737-6336759 CTTTTTCACTTAAAGAACAAGGG - Intergenic
951251317 3:20396974-20396996 CTCCCTGAGTTGAAGAATAAAGG - Intergenic
951418331 3:22452161-22452183 CTTCCTGATTTGAAGAACATGGG + Intergenic
952347776 3:32504315-32504337 GATAGTGACTTGAAGAATAATGG - Intergenic
952825553 3:37521595-37521617 CTTCTTGGCTTTTAGCATAATGG + Intronic
955694278 3:61620149-61620171 CTACGTGACTGGACGAATAAGGG + Intronic
956792544 3:72691281-72691303 CTTTCTCACTTGAATAATAATGG + Intergenic
956969965 3:74511410-74511432 CTTTATGCCTTGAAGGATAAAGG - Intronic
957912940 3:86646109-86646131 CTTCCAGATTTGAAGAATACAGG - Intergenic
959312979 3:104764137-104764159 CCTCTTCACTTGAAAGATAAAGG + Intergenic
959381787 3:105649753-105649775 CATCTTTACTTGAAGAAAGAAGG - Intergenic
960229929 3:115213804-115213826 GTTCTTGACATTAAAAATAATGG - Intergenic
960820685 3:121727560-121727582 CTTGTTGCCTTGAAGAATCAAGG + Intronic
961977334 3:131040700-131040722 CTTCTTCACTTGCCCAATAAAGG - Intronic
964254410 3:154759969-154759991 CTTGTTGATTTGAATCATAATGG + Intergenic
964999183 3:162930545-162930567 CTTCTTGACCTGAGGAATGTGGG + Intergenic
965239235 3:166173257-166173279 CTTCTTTACTTGAAAACTACTGG - Intergenic
965902997 3:173667382-173667404 ATTTTGGACTTGAAGAAAAATGG + Intronic
966067817 3:175837521-175837543 CTTTTGGCCTTGAAGAAGAAAGG - Intergenic
967407000 3:189127694-189127716 ATACTTGATTTGGAGAATAAAGG + Intronic
969230857 4:5829423-5829445 AGTATTCACTTGAAGAATAATGG - Intronic
970856064 4:20650663-20650685 CTGCTTGACTGGATGAACAATGG - Intergenic
971936377 4:33153620-33153642 CATCTTGACTAGAGGAATACAGG + Intergenic
972172841 4:36367683-36367705 CCTTTTTACTTGCAGAATAATGG - Intergenic
973555965 4:52083297-52083319 CTCCTTGAACTGAAGAATAGGGG + Intronic
973938225 4:55873574-55873596 CTTCTTGCCTTGTAAACTAATGG + Intronic
978131897 4:105208494-105208516 TTTCTTGCCTTTAAGTATAAGGG + Intronic
979120195 4:116889240-116889262 CTTCTTGGCTTGCAGAAAGATGG + Intergenic
979709343 4:123759656-123759678 CTTATTGACTTGATGTATAAGGG + Intergenic
980161871 4:129174074-129174096 CTTCTGAATTTGAAGATTAAGGG - Intergenic
980241907 4:130188826-130188848 CTTCTTACCGTGGAGAATAACGG - Intergenic
980576625 4:134690812-134690834 TTTATTGACTTGACAAATAAAGG + Intergenic
980809995 4:137865208-137865230 CTTCTTGACATGAGAAATATGGG - Intergenic
981038249 4:140194814-140194836 CTTCTTGAGTGGAAGAACCATGG + Intergenic
981977806 4:150752214-150752236 ATTCTTCACTATAAGAATAAAGG - Intronic
985037276 4:185853135-185853157 ATCCTTAACTTGAAGAAAAAGGG + Intronic
986964896 5:13258367-13258389 TTTCTTGAGTTGGAGAAAAATGG - Intergenic
987098138 5:14567871-14567893 CTTCTTGACCAGAAGAAATAGGG + Intergenic
987489366 5:18557014-18557036 CTTCAGGACTTGCAGAAAAAGGG - Intergenic
988832149 5:34998325-34998347 CTTCTTGAACTGAAGAGTGAGGG + Exonic
989308695 5:39987699-39987721 ATTCTTGACTTTAAGAACATGGG - Intergenic
989594109 5:43140273-43140295 CATCCTTACTTGATGAATAATGG + Intronic
991679515 5:69125075-69125097 TTTCTTGACTTAAAGAATTATGG - Intronic
991861098 5:71013931-71013953 CCTCTTAACTTCGAGAATAAGGG + Intronic
991961387 5:72048081-72048103 CTTCTTGGCTGGAAGAATTTTGG + Intergenic
992675873 5:79105971-79105993 CTTCTGAACTTCAAGAATAGAGG - Intronic
993148470 5:84128005-84128027 CTTCTTCAACTGAAGAATGAGGG - Intronic
996236565 5:121138036-121138058 CTTCTTGAGAGGGAGAATAATGG + Intergenic
996565520 5:124876258-124876280 CTGGTTGACTTAAAGAAGAAAGG + Intergenic
996861018 5:128065795-128065817 TTTCTTGACTTCTGGAATAATGG - Intergenic
997243757 5:132328521-132328543 CTTCTTGATTTGAAGGGCAAAGG - Intronic
997288669 5:132706176-132706198 ATTCTTGGCTTTAAGAAAAAAGG + Intronic
998030398 5:138862034-138862056 TTTCTTGACTTGAAGAATCTGGG + Intronic
999544157 5:152608350-152608372 CTTATTTATTTGTAGAATAAGGG + Intergenic
999573388 5:152946091-152946113 TTTATTGACTGGAAGAATCAAGG - Intergenic
1000210257 5:159101317-159101339 CTTTTTAACAGGAAGAATAAAGG - Intergenic
1004111097 6:12719894-12719916 CCTCTTGACTTTAAGAAGACTGG - Intronic
1008276221 6:49547654-49547676 TTTCTTTCCTTGAAGAATATTGG - Intergenic
1009716271 6:67400725-67400747 TATATTGACCTGAAGAATAAAGG + Intergenic
1009821096 6:68802028-68802050 TTTCTTCAAATGAAGAATAAGGG - Intronic
1010897818 6:81387167-81387189 CTTCTGGCCTTGGAGACTAAAGG - Intergenic
1012610948 6:101219077-101219099 CTTCATAACCTGAAAAATAATGG - Intergenic
1012923440 6:105244175-105244197 CTTCCTTTCTTGAAGAATACAGG - Intergenic
1013826920 6:114223627-114223649 TTTTTTGATTTGAAGAAAAATGG - Intronic
1014078219 6:117262253-117262275 CTTATTAACTTCAAGACTAAAGG + Intergenic
1016220051 6:141656488-141656510 CTCCATGACTTGTAGAGTAAGGG + Intergenic
1016724292 6:147343471-147343493 TTTCTTTTCTTGAAAAATAAAGG - Intronic
1016735593 6:147476095-147476117 CTTCCTGCCTTTAATAATAATGG + Intergenic
1017399410 6:154042012-154042034 CTTGTTGACTTGGAGAAACATGG + Intronic
1020464913 7:8466484-8466506 ATTTTTGACTGCAAGAATAAAGG + Intronic
1020934893 7:14450569-14450591 GGTGTTGACCTGAAGAATAAGGG - Intronic
1022341773 7:29475221-29475243 CTTCTTTTTTTGATGAATAAAGG - Intronic
1026329443 7:69339022-69339044 GCTCTTGACTTCAAGAAGAATGG - Intergenic
1028094781 7:86746540-86746562 TTTTTTGATTTGTAGAATAAAGG - Intronic
1033770504 7:144546156-144546178 CATGTTGACTTGAAGAAAAGTGG - Intronic
1034641259 7:152605314-152605336 ATTCTTGACTTTAAGGAGAATGG - Intergenic
1037048934 8:14344247-14344269 CTATTTTAATTGAAGAATAATGG + Intronic
1037867091 8:22453485-22453507 CTTCTGGACTTGAATATTCAGGG - Intronic
1038222913 8:25627743-25627765 TTTCTTGACCTGTAAAATAAGGG - Intergenic
1046582987 8:116115960-116115982 GTTCTTGATTTGAAGCATAGGGG + Intergenic
1048106087 8:131411629-131411651 ATTCTTGATTCCAAGAATAAGGG + Intergenic
1048678666 8:136813999-136814021 CTTCTTGACTTTCATAATCATGG - Intergenic
1050347404 9:4705037-4705059 CTTTTTGACTTTTAGAATAAAGG + Intronic
1050826064 9:9948003-9948025 CTTCTTGACTTTATGAAGAAGGG + Intronic
1050856295 9:10361142-10361164 CTTTTTGACTTTCAAAATAAGGG - Intronic
1051341652 9:16117641-16117663 CTCTTTGGCTTGAAGAATCAGGG - Intergenic
1051500125 9:17767668-17767690 ATCCTTCACTTAAAGAATAAGGG + Intronic
1052079201 9:24181793-24181815 CTTCATGCCTTGAACATTAATGG + Intergenic
1052913375 9:33904562-33904584 TTTTGTAACTTGAAGAATAAGGG + Intronic
1186986542 X:15020835-15020857 TTTCTTTGCTTGAAGAATATTGG - Intergenic
1187083903 X:16021846-16021868 CTTCAAGACTTGCAGACTAATGG + Intergenic
1187932624 X:24307497-24307519 CTTCTTGACATTAAAAGTAATGG + Intergenic
1188273268 X:28169977-28169999 CTTCTTGGCTTAAAGAAAAAAGG - Intergenic
1188413445 X:29902437-29902459 CTTATTCACTTGAAGGAAAAGGG - Intronic
1189135501 X:38545220-38545242 CTTCTTTACTCAAAAAATAAGGG + Intronic
1189487264 X:41443168-41443190 TTTCCTCACTTGAAGAATGAGGG + Intergenic
1190040852 X:47070915-47070937 CTTATTGCCATGAAAAATAATGG - Intergenic
1191134097 X:57045064-57045086 CTTCCTGACTGGTAGAATGAAGG - Intergenic
1191665917 X:63702502-63702524 CTTCTTCATTTGTAAAATAAGGG + Intronic
1192016797 X:67339907-67339929 GTTTTTGACTTGTAAAATAAGGG + Intergenic
1193147129 X:78088814-78088836 TTTCTTGAAATGAATAATAATGG - Intronic
1193679074 X:84495643-84495665 TTTTTTCATTTGAAGAATAAAGG - Intronic
1193679335 X:84499205-84499227 ATTCTTTACTTGTAAAATAAGGG + Intronic
1193868450 X:86766092-86766114 CATCTTGGCTTGGAGAAGAAAGG - Intronic
1195955207 X:110321196-110321218 TCTCTTGACTTGAAGTATAAAGG + Intronic
1196156025 X:112431336-112431358 CTTCTCTACCAGAAGAATAAAGG + Intergenic
1196275680 X:113763002-113763024 CTCCCTGACTGGTAGAATAAGGG + Intergenic
1196867628 X:120084302-120084324 CTTTTTCACTCGAAGAGTAAGGG + Intergenic
1196875473 X:120151979-120152001 CTTTTTCACTCGAAGAGTAAGGG - Intergenic