ID: 1164745700

View in Genome Browser
Species Human (GRCh38)
Location 19:30611143-30611165
Sequence TATTCTACCCCCAGAGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164745700_1164745707 28 Left 1164745700 19:30611143-30611165 CCAAACCCTCTGGGGGTAGAATA 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1164745707 19:30611194-30611216 CATCTATCCTCCAAGATGATGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1164745700_1164745703 4 Left 1164745700 19:30611143-30611165 CCAAACCCTCTGGGGGTAGAATA 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1164745703 19:30611170-30611192 ACCTGTTCATTTGACATTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 124
1164745700_1164745705 5 Left 1164745700 19:30611143-30611165 CCAAACCCTCTGGGGGTAGAATA 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1164745705 19:30611171-30611193 CCTGTTCATTTGACATTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 113
1164745700_1164745706 27 Left 1164745700 19:30611143-30611165 CCAAACCCTCTGGGGGTAGAATA 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1164745706 19:30611193-30611215 GCATCTATCCTCCAAGATGATGG 0: 1
1: 0
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164745700 Original CRISPR TATTCTACCCCCAGAGGGTT TGG (reversed) Intronic
900073955 1:797030-797052 TATATTACCACCAGAGAGTTTGG - Intergenic
902078824 1:13807087-13807109 TATTCAGCCCCCAGTGGTTTTGG - Intronic
910832948 1:91478688-91478710 TCTTCTGCCCCCAAAGGGTCTGG - Intergenic
913317793 1:117567254-117567276 TATTCTGCCCCAGGAGGGGTTGG + Intergenic
914351084 1:146841039-146841061 TTTTCCACTCCCAGAAGGTTGGG + Intergenic
917954053 1:180074288-180074310 TATCTTAGGCCCAGAGGGTTAGG - Intronic
919802509 1:201362086-201362108 TGCTCCACCCCCAGGGGGTTTGG - Intronic
922269810 1:224021938-224021960 TATATTACCACCAGAGAGTTTGG - Intergenic
923680252 1:236112937-236112959 TATTCTACCTCCAGAGCAGTGGG + Intergenic
923971333 1:239206240-239206262 TATTATAGCCCCAGAGGCCTAGG + Intergenic
924307307 1:242703446-242703468 TATACTACCCCCTCAGGGATGGG - Intergenic
1074847173 10:117408593-117408615 TAATCTTCCCACAGAGGCTTAGG + Intergenic
1079617044 11:22508022-22508044 TATTCTAACTCCAGAAGGTTGGG + Intergenic
1083105047 11:60349306-60349328 TATTCCATACCAAGAGGGTTTGG + Intronic
1091033901 11:132215980-132216002 TTTTCTACCTACAGAAGGTTAGG - Intronic
1094107303 12:26828033-26828055 TATAATACCCCCAGGGGGATGGG + Intronic
1100128532 12:91460676-91460698 GATTCTACCCCCAGTGATTTAGG - Intergenic
1104778787 12:131406402-131406424 TATTCTACCCTCAGAGTCTCTGG - Intergenic
1109142179 13:58727484-58727506 AATTCAACCCCAACAGGGTTAGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1125488231 15:40127154-40127176 TATTCTACCCCCTGAAAATTAGG - Intergenic
1128539300 15:68515266-68515288 ACTTAGACCCCCAGAGGGTTGGG - Intergenic
1130041042 15:80405068-80405090 TTTTGTGCCCCCGGAGGGTTAGG - Intronic
1130330794 15:82920821-82920843 TGTTTTACCCCCAGAGTGGTAGG - Intronic
1131781647 15:95866066-95866088 TTTTTTACTACCAGAGGGTTTGG + Intergenic
1134002059 16:10790578-10790600 TATTTTACCCCAAGATGGTCGGG - Intronic
1136280818 16:29210162-29210184 TACTCCACTCCCAGAGGGCTGGG + Intergenic
1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG + Intronic
1138250920 16:55501397-55501419 CATTCTACCCACAGAAGGTGGGG - Intronic
1138994095 16:62427337-62427359 TATTTCTCCCCCAGAGAGTTTGG - Intergenic
1139982953 16:70874507-70874529 TTTTCCACTCCCAGAAGGTTGGG - Exonic
1142085174 16:88176084-88176106 TACTCCACTCCCAGAGGGCTGGG + Intergenic
1146452364 17:32984902-32984924 AGTTCTACCCCCAGAGATTTTGG + Intronic
1148706596 17:49639097-49639119 CTTTCTATCCTCAGAGGGTTGGG - Intronic
1153181677 18:2442033-2442055 AATACTATCCCCAGAAGGTTTGG - Intergenic
1154933514 18:21026537-21026559 TATTATACTCACAGAGTGTTAGG + Intronic
1159462284 18:68737066-68737088 TACTCTGCCCTCAGAGGGTTGGG + Intronic
1161587604 19:5114018-5114040 TATTCTTCCCCCTGATGGATGGG + Intronic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG + Intronic
925661880 2:6211295-6211317 TATTATATCCCCAGATGCTTTGG + Intergenic
925852685 2:8098382-8098404 TATTCTCCTCCAAGATGGTTTGG - Intergenic
927201115 2:20578573-20578595 TATTCACCTCCCAGAGGGTCTGG - Intronic
931286534 2:60836504-60836526 AATTCTACCCCCAGCGGGGAGGG - Intergenic
933363394 2:81316323-81316345 TCATCTACCCCCAGAGGTCTTGG + Intergenic
935752139 2:106245048-106245070 CATTCTTCCCCCAGAGGTATAGG - Intergenic
935912551 2:107912595-107912617 CATTCTTCCCCCAGAGGTATAGG - Intergenic
938574875 2:132594485-132594507 ATTTCTACGCCCAGAGGGATAGG - Intronic
942809923 2:179986362-179986384 TATTGTACCGCAAGAGGGGTTGG - Intronic
948468499 2:238163445-238163467 TATTTTACCCCCAGCGTCTTTGG + Intronic
948739447 2:240033316-240033338 AATTCTTCCCTCAGAGGGTGCGG - Intergenic
1173152321 20:40578160-40578182 TCTTCTGGCCTCAGAGGGTTAGG + Intergenic
1175656931 20:60779141-60779163 GATTCTGCCACCTGAGGGTTTGG + Intergenic
1177594894 21:23225962-23225984 TATTCCTCCCCCTGAGGATTGGG + Intergenic
952226433 3:31381504-31381526 TATTTTACCCCCACTTGGTTTGG - Intergenic
953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG + Intergenic
954883506 3:53852107-53852129 TACTTTACCACCAGAGGGTCTGG - Exonic
961252155 3:125516485-125516507 TATCCTACCCCAAGAGGTTGTGG - Intronic
962573207 3:136732368-136732390 TATTCTGCACACAGAAGGTTAGG - Intronic
980497173 4:133601079-133601101 AATTCAACCCCCAATGGGTTTGG - Intergenic
984631762 4:182068181-182068203 TATTCTATCCGCAAAGGGTTTGG - Intergenic
985077517 4:186231070-186231092 TATCCTACCCCCTGGGGATTTGG - Intronic
993310476 5:86325349-86325371 TGCTCTACCTCCAGAGGGTCTGG + Intergenic
1009201579 6:60752715-60752737 TAATCTACCCCCAGATATTTCGG + Intergenic
1012805330 6:103886067-103886089 GATTCTACCTCCAGTGGATTTGG - Intergenic
1016867654 6:148783829-148783851 TTTTCTGTCCCCAGGGGGTTGGG + Intronic
1021788670 7:24178245-24178267 TCCTCTATCACCAGAGGGTTGGG + Intergenic
1022483327 7:30758580-30758602 TGTTATTCCCCCAGAGGGTCAGG + Intronic
1024447005 7:49492439-49492461 TAATCAACCCCAAGTGGGTTAGG - Intergenic
1031087471 7:117317475-117317497 CATTTTACCTCCAGATGGTTTGG + Intronic
1031793821 7:126145273-126145295 TATAATATTCCCAGAGGGTTTGG + Intergenic
1033889356 7:145990604-145990626 TATTCTATCAACAGAAGGTTGGG + Intergenic
1035541679 8:444447-444469 TATATTACCACCAGAGAGTTTGG + Intronic
1037933573 8:22899195-22899217 TTTTCTACCTCCAGAGAGCTGGG - Intronic
1038434082 8:27522487-27522509 TCTTCTACCCCGAGAGAGTGAGG + Exonic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1048859403 8:138712822-138712844 TGTTCTACCAGCAGAGGGTAAGG + Intronic
1055149014 9:72972691-72972713 TATTCTACCCACAGTGGCTTAGG + Intronic
1057073260 9:92118707-92118729 TCTTCTCCCCCCAGAGCCTTTGG - Intergenic
1057088319 9:92231737-92231759 TTTTCTACCTCCAGATGGTATGG + Intronic
1061642399 9:131969611-131969633 TATTCTAGCCCAAGAGGGATTGG + Intronic
1187554886 X:20342152-20342174 TACTCTACTCCCAGTGGGTTGGG + Intergenic
1188280390 X:28260771-28260793 TAATATAGCCCCAGAAGGTTAGG - Intergenic
1189175144 X:38949174-38949196 TATTCTACTCCCAGACTTTTTGG + Intergenic
1191035240 X:56018566-56018588 TATTTTTCCCTCAGAGAGTTAGG - Intergenic