ID: 1164745863

View in Genome Browser
Species Human (GRCh38)
Location 19:30612435-30612457
Sequence TGCCCACTTGATTCTCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164745855_1164745863 10 Left 1164745855 19:30612402-30612424 CCATCACCTCTTTACCAACCAGA 0: 1
1: 0
2: 2
3: 13
4: 213
Right 1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 139
1164745861_1164745863 -4 Left 1164745861 19:30612416-30612438 CCAACCAGAGGAAACGGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 95
Right 1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 139
1164745854_1164745863 25 Left 1164745854 19:30612387-30612409 CCTGACTTTGCGGGACCATCACC 0: 1
1: 0
2: 0
3: 4
4: 36
Right 1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 139
1164745862_1164745863 -8 Left 1164745862 19:30612420-30612442 CCAGAGGAAACGGGGTGCCCACT 0: 1
1: 1
2: 1
3: 10
4: 95
Right 1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 139
1164745857_1164745863 4 Left 1164745857 19:30612408-30612430 CCTCTTTACCAACCAGAGGAAAC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG 0: 1
1: 0
2: 2
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164745863 Original CRISPR TGCCCACTTGATTCTCACTG AGG Intronic
903293109 1:22327021-22327043 TGCCCACATGATCCTCTCTGAGG + Intergenic
903916198 1:26766233-26766255 TGCCCCCTTGATTCATATTGGGG - Exonic
903925751 1:26829328-26829350 TGCCCTTTTGATTCTAACTCAGG + Intronic
904306302 1:29592415-29592437 TGCCCACTTGATTCTCCACATGG - Intergenic
905322601 1:37128552-37128574 TACCTACTTGAATCTCCCTGTGG + Intergenic
906569109 1:46821029-46821051 TGCTAACTTGATTCCCAATGTGG + Intergenic
907261406 1:53221147-53221169 TGTCCACATCCTTCTCACTGTGG + Intergenic
907291780 1:53418636-53418658 TGCCCCCTTGCTTCCCACTCTGG + Intergenic
909097630 1:71308149-71308171 TGGCTAATTGATTTTCACTGTGG + Intergenic
909419843 1:75451101-75451123 TACCCACTGGATTCTCCCTTGGG + Intronic
909935851 1:81549790-81549812 TTCCCATTTGCTTCTCACTTGGG - Intronic
912952851 1:114132400-114132422 TGCCCAGTGGCTTATCACTGTGG + Intronic
916430290 1:164721336-164721358 TTTCTACTTGATTCTCAGTGTGG + Intronic
921026439 1:211287367-211287389 TGCATACTTGATTCTCCCTCTGG + Intronic
921914604 1:220593648-220593670 TGCCCCCTTGTTTCTCTTTGGGG + Intronic
922504719 1:226119795-226119817 TGCCCTCTTCATTCCCATTGAGG - Intergenic
923283222 1:232465100-232465122 TGCCCACTTGTTTAGCATTGGGG - Exonic
924785739 1:247197049-247197071 TGCCCATTTTATTCTCTCTCCGG - Intergenic
1063428911 10:5971638-5971660 TGCCCTCAGGATGCTCACTGTGG + Intronic
1063476204 10:6330997-6331019 TACCCATTTGATGCCCACTGTGG - Intergenic
1063652650 10:7953816-7953838 TGCACTCTTGAGTCTCACTATGG - Intronic
1064222070 10:13449924-13449946 TACCAACTTGATTGTCACCGGGG - Intronic
1067717172 10:48698580-48698602 TGCTCAATTTATTCTCAGTGGGG + Intronic
1068413822 10:56691020-56691042 TGCTCACTTATTTCTCACTTGGG + Intergenic
1070300237 10:75198270-75198292 TGCCCAATTTACCCTCACTGTGG + Intergenic
1070843340 10:79503197-79503219 AGCTCCCTTGGTTCTCACTGTGG + Intergenic
1072305325 10:94101559-94101581 TGCCCACTTGCTTCTCAGGGGGG - Intronic
1077454511 11:2670475-2670497 GGCCCACTAGATGCTCTCTGAGG - Intronic
1077794456 11:5477338-5477360 TGCCCACTGGTTCCCCACTGAGG - Intronic
1081636520 11:44726026-44726048 TGGCCAGCTGATTCTCACTAAGG - Intergenic
1081720236 11:45283642-45283664 TGCCCACATCTTTGTCACTGAGG + Intronic
1085316657 11:75549186-75549208 TGCCTAGTTCATTCTAACTGTGG + Intergenic
1086433132 11:86755225-86755247 TGCTCACTAGATTCTCTCTAGGG + Intergenic
1086836321 11:91628025-91628047 TTCCTACTTGATGCTCACAGAGG - Intergenic
1087178635 11:95120141-95120163 AGCCCACTTGATGCTCTCTGTGG + Intronic
1088075614 11:105845104-105845126 TAGCTACTTGATTCTCACTCAGG + Intronic
1090910120 11:131111349-131111371 TACCCACTTCCTCCTCACTGAGG - Intergenic
1093008399 12:14077829-14077851 TGCCCACTTGCTCTGCACTGAGG + Intergenic
1093842975 12:23928053-23928075 TGCCCAGTAGATTTTCACTGGGG - Intronic
1094035593 12:26066969-26066991 TTCCCACAAGATTCTCACTATGG - Intronic
1094180800 12:27590757-27590779 GACACACTTGCTTCTCACTGGGG - Intronic
1095294797 12:40515680-40515702 TGCTCTGTTCATTCTCACTGGGG - Intronic
1096048201 12:48582889-48582911 TGCAGACTTGTCTCTCACTGAGG - Intergenic
1099175247 12:79414018-79414040 TGCCCACTAAATTTTCATTGGGG - Intronic
1104120272 12:125791839-125791861 TGCCCACTTGCTTCACACCCAGG - Intergenic
1108166921 13:47702836-47702858 TGCCCACTTGGTTCACAAAGAGG + Intergenic
1109927590 13:69166250-69166272 AGCCCATTTGATCCTCACTGTGG - Intergenic
1110645358 13:77877354-77877376 TCCCCACTTGAATCTCACCTTGG + Intergenic
1112099783 13:96175783-96175805 TATCCTCTTGATTCTCTCTGAGG + Intronic
1112223244 13:97513152-97513174 TGCCCACTGGATTCCCCCAGTGG - Intergenic
1114344192 14:21778530-21778552 TGCCCACTTGGTGCTCCCTTGGG - Intergenic
1117966727 14:61214091-61214113 AGCCCACGTGAGTCACACTGTGG + Intronic
1118479767 14:66152663-66152685 TGCCCACTTAATTCTAACCCTGG - Intergenic
1118687594 14:68306756-68306778 TTCCCACTGGAATCTCACTTCGG - Intronic
1122316897 14:100831048-100831070 AGCCCACTCGAATCTCACTGGGG - Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125278450 15:38018356-38018378 TGGCCACTTAACTCTCTCTGAGG - Intergenic
1125492979 15:40162122-40162144 TGAACACTGGAGTCTCACTGAGG + Intronic
1127658753 15:61080375-61080397 TGCCCTCTAGTTTCTCACTCTGG - Intronic
1128760328 15:70212432-70212454 TCCCCACTTGACGCTCACTTAGG + Intergenic
1131725285 15:95215698-95215720 TGCTTACTTGATTCACCCTGAGG - Intergenic
1131891335 15:96974761-96974783 TGCCCAGTTGTTTTCCACTGTGG + Intergenic
1134562672 16:15224143-15224165 TGTCCACTTCACTCTCACTATGG - Intergenic
1134923211 16:18135770-18135792 TGTCCACTTCACTCTCACTATGG - Intergenic
1136077198 16:27825269-27825291 TGCCGTCTTGTTTCCCACTGTGG - Intronic
1138867325 16:60838272-60838294 CTCCCACATAATTCTCACTGGGG - Intergenic
1143040827 17:4035271-4035293 TGCCCTCTTGAGTCACACTGAGG - Intronic
1146503056 17:33380954-33380976 GGCCCACTTTTTTCTCACTGGGG - Intronic
1151977330 17:77490160-77490182 TGACCGATTTATTCTCACTGTGG + Intronic
1153579768 18:6561216-6561238 TGCCAAGTTTTTTCTCACTGAGG - Intronic
1156259979 18:35437277-35437299 TTCCCACTTGCTGCTGACTGTGG + Intergenic
1157313090 18:46566696-46566718 TCCCCTCTTGTTTCTCACTATGG - Intronic
1160671360 19:365378-365400 TGCCTACTAAATTCTCACAGAGG - Intronic
1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG + Intronic
1165382630 19:35491977-35491999 TGGCCACCTGAACCTCACTGTGG - Intronic
924986993 2:281055-281077 TGCCCTCTGGTGTCTCACTGAGG + Intronic
925535884 2:4916130-4916152 TGCCCACTTAATTGTCACTGGGG + Intergenic
926784871 2:16508992-16509014 TTCCCTCTTGATTCTCACTGTGG - Intergenic
928617076 2:33051511-33051533 AGCCCCCTTCATTCTGACTGTGG + Intronic
932056501 2:68448656-68448678 TGACCACTTCGTCCTCACTGCGG - Intergenic
933120393 2:78529166-78529188 TTACCAGTGGATTCTCACTGTGG + Intergenic
934982824 2:98860479-98860501 TGGCCAATTGATTTTCAATGAGG + Intronic
935140153 2:100345729-100345751 TGCACACTTGATACTGACTTGGG + Intergenic
935305059 2:101729718-101729740 TGCCCACATGTGTCTAACTGAGG + Intronic
936621952 2:114109271-114109293 TGGCCACTCAATTCTGACTGTGG - Intergenic
936869052 2:117110630-117110652 TGCCAACTTGAGTGTCCCTGTGG + Intergenic
939167157 2:138652333-138652355 TGCCCACTGCAGTGTCACTGTGG - Intergenic
939997092 2:148930129-148930151 AGCCCACTTCATGCACACTGGGG + Intronic
940327973 2:152444922-152444944 ACCCCTCTTGATTCTCTCTGAGG + Intronic
940630544 2:156232518-156232540 TTCCAATTTTATTCTCACTGTGG - Intergenic
941203765 2:162546540-162546562 TGTCCCCAGGATTCTCACTGCGG - Intronic
942757156 2:179355342-179355364 TGCCAACTTGGATCTTACTGAGG - Intergenic
945994261 2:216422564-216422586 TGACAACTTGATTCTCACAGTGG - Intronic
946119332 2:217495765-217495787 TGCCCACTACATTCTCAATGTGG + Intronic
946163957 2:217852510-217852532 TGCCCCCATGGCTCTCACTGTGG - Intronic
947887858 2:233589650-233589672 TGGCCAATTGATTTTTACTGTGG + Intergenic
947894080 2:233652676-233652698 TGGCCAATTGATTTTTACTGTGG + Intronic
1168865741 20:1084937-1084959 TGGCCATTTGTTTCTCACTAAGG + Intergenic
1170935521 20:20805858-20805880 CACCCACTTGTCTCTCACTGAGG - Intergenic
1174231820 20:49051561-49051583 TGCCCACTTCATTCTCATTCAGG - Intronic
1179632837 21:42689148-42689170 TGCCCACTGAAGCCTCACTGAGG - Intronic
1182836886 22:33349435-33349457 TTCCCACATGATTCTCTCTGAGG + Intronic
1185182870 22:49373130-49373152 TGCCCACGTGGTCATCACTGAGG - Intergenic
949178085 3:1091256-1091278 TACCCACTTGTCTCTCTCTGTGG - Intergenic
951491872 3:23279886-23279908 TGGCCACTTAATTTTCTCTGAGG + Intronic
953240805 3:41147882-41147904 TGCTCTCCTGTTTCTCACTGGGG - Intergenic
956064224 3:65379827-65379849 TGCAGACTTGATTCTGAGTGTGG - Intronic
956338425 3:68191794-68191816 TGGGCACCTGATTTTCACTGTGG + Intronic
960382299 3:116978493-116978515 TGGCAACTTGATTGTCAGTGTGG - Intronic
961485902 3:127216327-127216349 GGCCCTGTTGATTCTCACAGAGG - Intergenic
961553789 3:127683806-127683828 TCCCCACTTGCTGCTCGCTGCGG - Intergenic
966100903 3:176268029-176268051 TTCCAACTTGATGCTAACTGGGG + Intergenic
968657576 4:1785338-1785360 TGCCCCTTTGATCCACACTGAGG + Intergenic
970619113 4:17798754-17798776 TGCAAACTTAAGTCTCACTGCGG + Intergenic
971171635 4:24239747-24239769 TGCACACTAGAATCTCACTCAGG + Intergenic
972775979 4:42240877-42240899 TACCCACTTTATACTGACTGGGG + Intergenic
975996047 4:80316911-80316933 TGGTCAATTGATTTTCACTGAGG + Intronic
976847736 4:89509578-89509600 TGTCCAATTCAATCTCACTGAGG - Intergenic
978406234 4:108381957-108381979 TGCCAAATTGCTTTTCACTGGGG - Intergenic
983551059 4:169017929-169017951 TGCCCCCTTAATGCTCTCTGAGG + Intergenic
984836850 4:184030287-184030309 TGGCCACTTCACTCTGACTGAGG + Intergenic
985867447 5:2524866-2524888 TGCCCGCTGCACTCTCACTGAGG - Intergenic
989336124 5:40319195-40319217 TGCCCTCTTGCTTCACTCTGGGG + Intergenic
991561480 5:67958201-67958223 TTTCCACGTGGTTCTCACTGCGG - Intergenic
992960325 5:81951606-81951628 TGCCACCTTGAATTTCACTGTGG - Intergenic
993041060 5:82815368-82815390 TTCCCAGTTCCTTCTCACTGTGG + Intergenic
996138529 5:119875067-119875089 TGACCAGTTGATTCTATCTGGGG - Intergenic
1000589681 5:163143817-163143839 TGCCCACTGAATTCTCCCTAAGG - Intergenic
1001023661 5:168205386-168205408 TGCCCACATGATTTTGTCTGTGG - Intronic
1004478534 6:15997413-15997435 TGCCCACTTAAAACTGACTGTGG - Intergenic
1004969819 6:20897323-20897345 TGCCCAATTCATTCCTACTGGGG - Intronic
1007941194 6:45782895-45782917 TGGCAACTTGTTTCTCAGTGTGG + Intergenic
1010178814 6:73060303-73060325 TCCCAACTTCATTCTCACTCTGG + Intronic
1012235333 6:96807333-96807355 TAGCCACTGGATACTCACTGTGG + Intronic
1014254453 6:119147345-119147367 TGAAGACTTGATTCTGACTGGGG + Intronic
1014489791 6:122047642-122047664 ATCCCAATTGACTCTCACTGGGG + Intergenic
1020439137 7:8198753-8198775 TGCTCCCTTTATTGTCACTGAGG - Intronic
1021617419 7:22517381-22517403 TCCCCACTAGCTTCTTACTGTGG + Intronic
1022927007 7:35066795-35066817 TCCCCACTAGCTTCTTACTGTGG + Intergenic
1023891191 7:44393093-44393115 TCCCCACTTCTTCCTCACTGGGG + Intronic
1024047475 7:45594881-45594903 TCCCCACGTGATTGTCATTGTGG + Intronic
1028375255 7:90138728-90138750 TCCCCACTAGCTTCTTACTGTGG - Intergenic
1034268449 7:149792176-149792198 TGCCCACCTGATTGGCCCTGCGG + Intergenic
1037291787 8:17358469-17358491 TGCTCAATTGATTCTGACAGAGG - Intronic
1041258388 8:55999086-55999108 TGCCCACGTGGTTATGACTGAGG + Intronic
1048242324 8:132755065-132755087 TGCCCCATTAATTCTCACAGAGG - Intronic
1056310899 9:85339870-85339892 TGCCCACTGGACCCTCAGTGGGG - Intergenic
1056404898 9:86264093-86264115 TGCCGACTTGAAGCTCTCTGAGG + Intergenic
1056911476 9:90704832-90704854 TGGCCACTGGATTCACTCTGGGG - Intergenic
1185732983 X:2475969-2475991 AGCCCACTTGATTCACACCAAGG + Intronic
1187560941 X:20403120-20403142 GGCCCACTTGAGTCACACTTGGG - Intergenic
1188511880 X:30944965-30944987 TGCCCACTGGATCCACAATGAGG - Intronic
1190547795 X:51547185-51547207 TGGCAATTTGATTCTCAATGTGG - Intergenic
1200234883 X:154463504-154463526 GGCCCACCTGCTTCTCACTCAGG - Exonic