ID: 1164745868

View in Genome Browser
Species Human (GRCh38)
Location 19:30612459-30612481
Sequence CTCTGGATATGGAGATACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164745857_1164745868 28 Left 1164745857 19:30612408-30612430 CCTCTTTACCAACCAGAGGAAAC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG 0: 1
1: 0
2: 0
3: 13
4: 130
1164745865_1164745868 -2 Left 1164745865 19:30612438-30612460 CCACTTGATTCTCACTGAGGTCT 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG 0: 1
1: 0
2: 0
3: 13
4: 130
1164745861_1164745868 20 Left 1164745861 19:30612416-30612438 CCAACCAGAGGAAACGGGGTGCC 0: 1
1: 0
2: 1
3: 3
4: 95
Right 1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG 0: 1
1: 0
2: 0
3: 13
4: 130
1164745862_1164745868 16 Left 1164745862 19:30612420-30612442 CCAGAGGAAACGGGGTGCCCACT 0: 1
1: 1
2: 1
3: 10
4: 95
Right 1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG 0: 1
1: 0
2: 0
3: 13
4: 130
1164745864_1164745868 -1 Left 1164745864 19:30612437-30612459 CCCACTTGATTCTCACTGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164745868 Original CRISPR CTCTGGATATGGAGATACCA TGG Intronic
901069259 1:6509126-6509148 CTCTGGACAGGAAGATCCCAGGG + Intronic
902659666 1:17892304-17892326 CTCTGCAGATGGAGAAACCGAGG - Intergenic
902745739 1:18473162-18473184 TTCTGGATAAGCAGAAACCAGGG - Intergenic
902955476 1:19922055-19922077 CTGTGGGTAGGGAGATACCTGGG + Intronic
904602276 1:31680181-31680203 CTCTAGAGATGGAGAGGCCAGGG + Intronic
905028143 1:34865324-34865346 CTCTTGGTTTGGAGATAGCAGGG - Intergenic
907718448 1:56949864-56949886 CTCTGGATACAGAGAAATCAGGG + Intronic
912199506 1:107440360-107440382 CTCTGGATTCGTAGAGACCAGGG + Intronic
913300134 1:117361450-117361472 CTCTGGAGCTGGAGAAACCTGGG - Intergenic
916165860 1:161966911-161966933 CTCAGGAAATGGAGATAACTCGG - Intergenic
916749833 1:167714067-167714089 ATCTGCAAATGGAGATACAATGG + Intergenic
923458109 1:234183631-234183653 ATATGGATATAGAGCTACCAAGG - Intronic
1069586645 10:69609261-69609283 TTCATGATATGGACATACCACGG - Intergenic
1072043540 10:91632849-91632871 CTCTGGAAATGGACACCCCAGGG - Intronic
1073559704 10:104486449-104486471 CTCTGGGTAGGGAGAGACCAGGG + Intergenic
1073703812 10:105959731-105959753 CTCTGGATATTGTGATATCTTGG - Intergenic
1073797800 10:107007007-107007029 GTCGGGACATGGAGATACAAGGG - Intronic
1076550698 10:131276177-131276199 CTCCTGATATGGGGTTACCATGG + Intronic
1078358586 11:10650865-10650887 CTTGGGATATGCAGATACAAAGG + Intronic
1082206111 11:49436051-49436073 CTGTGGAAACGGAGATAACATGG + Intergenic
1086385172 11:86299742-86299764 CTCAGGAACTGGAGATATCAGGG - Intergenic
1086649153 11:89265720-89265742 CTATGGAAAGGGAGATAACATGG - Intronic
1087089770 11:94256705-94256727 CTCTGCATGTGAAGATACCATGG - Intergenic
1087870407 11:103286894-103286916 CACTGTATATGGAGACACAAAGG - Intronic
1096438889 12:51621618-51621640 CTCTGGATGTGGAGAGACTAGGG + Intronic
1097061857 12:56290963-56290985 GTTTAGATATGGAGTTACCAAGG + Intronic
1102546927 12:113664068-113664090 CCCTGGGTAGGGAGAGACCAGGG + Intergenic
1105249687 13:18686797-18686819 ATTTGGATATGGAGATATTATGG - Intergenic
1113092715 13:106632078-106632100 CTCTGGAGGTGGGGAGACCAGGG - Intergenic
1116480218 14:45388254-45388276 CTCTTGATAGGGAAATGCCAAGG - Intergenic
1121111994 14:91318840-91318862 CCCAGGAGATGGAGATAGCAAGG + Intronic
1122342792 14:101039210-101039232 CTCTGGATGTGAAGAGGCCAGGG + Intergenic
1125358707 15:38843437-38843459 CTCTGGATACAGAGATTCCAGGG + Intergenic
1127309908 15:57743497-57743519 ATCTGGATGTGGAAATACAAAGG - Intronic
1129112810 15:73347805-73347827 CTCTGGATTTGGAGAGACTAGGG - Intronic
1130104455 15:80919040-80919062 GCATGGATATTGAGATACCAGGG - Intronic
1134810515 16:17163300-17163322 CTCTGGACATGAAGATATGAAGG + Intronic
1144581871 17:16463760-16463782 CTCTACAGATGGAGACACCAAGG + Intronic
1144794949 17:17884812-17884834 CTTTGGATTTTCAGATACCATGG - Intronic
1149797144 17:59531016-59531038 CTGTGGATATGGAAATATTAAGG + Intergenic
1150564614 17:66327965-66327987 GACTGCATATGGAGTTACCAAGG + Intronic
1156376709 18:36521324-36521346 CAATGGAGATGGAGATACCAGGG - Intronic
1158903615 18:61989069-61989091 CTCTGGATATTGACATGCCCAGG - Intergenic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1160242585 18:77133645-77133667 ATCTGGATCTGGAGCTTCCAGGG + Intronic
1163827394 19:19531272-19531294 CTGTGGCTCTGGAGACACCAAGG + Intronic
1163885803 19:19963704-19963726 CTCTGGGTATGCAGATCCTATGG + Intergenic
1163888691 19:19991966-19991988 CTCTGGGTATGCAGATCCTATGG - Intergenic
1163949467 19:20570518-20570540 CTCTGGGTATGCAGATCCTATGG + Intronic
1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG + Intronic
1164831488 19:31324791-31324813 CTCTGGGTATAGTGATTCCATGG + Intronic
1166054459 19:40280113-40280135 CTCTGGAATTGGAAAGACCAGGG - Intronic
1167224347 19:48227438-48227460 CTCTGAATATTGAGTTTCCAGGG - Intronic
1167561492 19:50228639-50228661 ACCTGGATATGCAGGTACCATGG - Intronic
925267625 2:2577592-2577614 CTCTGGATTTGCAAATCCCAGGG - Intergenic
926002756 2:9347047-9347069 CTCTGGAAGTGGAGATTCCCTGG - Intronic
927282313 2:21319976-21319998 CTCTGGATATTGAGGTGCCTGGG + Intergenic
928635565 2:33242374-33242396 CTCTGCATATGGAGATCCAGGGG - Intronic
929397789 2:41543442-41543464 CTTTGGATGTGAAGAGACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931881719 2:66576424-66576446 CTCTGGAGATGGGGCGACCAGGG + Intergenic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
933525037 2:83426539-83426561 CTCTGCTCATGGAGCTACCATGG + Intergenic
934603749 2:95678914-95678936 TTCTGGATGTGGAGAATCCAGGG - Intergenic
934966103 2:98723939-98723961 TTCTGTAAATGGAGAAACCAAGG - Intronic
936537128 2:113321144-113321166 TTCTGGATGTGGAGAATCCAGGG - Intergenic
940765376 2:157784586-157784608 CTCTGGCTCTGGTGATACAAAGG - Intronic
946801799 2:223425344-223425366 CTCTGGGTAGATAGATACCAAGG + Intergenic
946950946 2:224874372-224874394 ATCTGGATATTTAGATACCAAGG - Intronic
948707571 2:239804609-239804631 CTCTGGAGATGGTCAGACCATGG + Intergenic
1171294349 20:24004601-24004623 CAGTGGATAAGGAGATAACAGGG - Intergenic
1173161448 20:40655579-40655601 CCCTGGATGTGGAGATCCAAGGG + Intergenic
1175183516 20:57164952-57164974 CATTGGAAATGCAGATACCAGGG - Intergenic
1179096917 21:38324330-38324352 ATCTGCATATGGAGATGCCAAGG + Intergenic
1179101311 21:38357542-38357564 TTCTGTAGATGGAGATGCCAGGG - Intergenic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1181466093 22:23111456-23111478 CTCTGGAAACGGAGATGCCAAGG + Intronic
1181630488 22:24148625-24148647 CTTTGGAAATGGAGAAACTAAGG - Intronic
951339498 3:21467639-21467661 ATCAGGATATTGAGTTACCAGGG - Intronic
955958406 3:64313863-64313885 CTCTGGTTCTGGAGAATCCAAGG - Intronic
956398665 3:68852567-68852589 CTCAGGGTATGGAGAACCCAGGG + Intronic
956887103 3:73571254-73571276 CACTGGATATGGAGAAAAAAGGG - Intronic
959952302 3:112193602-112193624 CTCTGGGTATGGGGATGGCATGG + Intronic
961638498 3:128349921-128349943 CTCTGGAAATGCAGATGCCTGGG + Intronic
962931442 3:140041383-140041405 TCCTGGATATGGAGAGACAAGGG - Intronic
962962182 3:140321238-140321260 CTATGGATATGGAGAGTCCAGGG - Intronic
963560916 3:146863714-146863736 CTCTGGGCATGGAGAAACAAAGG - Intergenic
963758247 3:149258763-149258785 CTAGGGATGTGGAGATACAAGGG - Intergenic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
966280196 3:178217255-178217277 TTAGGGATATAGAGATACCAGGG + Intergenic
968417677 4:454165-454187 CTCTGGATATGTGGATACTACGG + Intronic
969593054 4:8132776-8132798 ATCTGTAAATGGGGATACCACGG + Intronic
970208377 4:13679933-13679955 CTCTGGATATGGAGATGGAAAGG + Intergenic
971739018 4:30497056-30497078 CTCTGGATAAGGAAATAGAATGG + Intergenic
974303008 4:60094045-60094067 CACTGGATATGGATAGACTATGG + Intergenic
976522326 4:86042938-86042960 ATCTGGATAATGAGATACCTTGG - Intronic
979411775 4:120388062-120388084 CTGTGGTTATGCAGAGACCAAGG + Intergenic
979546479 4:121945761-121945783 CTCTAGACGTGGGGATACCAGGG + Intronic
982418391 4:155164065-155164087 GTATGGGTATGGAGACACCAGGG + Intergenic
984907986 4:184648273-184648295 GTCTGGAAGTGGAGAGACCAGGG + Intronic
987883073 5:23774974-23774996 ATCTGGATTTGGAGAAATCATGG - Intergenic
992713532 5:79485862-79485884 CTCTTGATAGGGAAATAACAAGG - Intronic
999118441 5:149186075-149186097 CTCTGGAGAGGGAGAGAGCAAGG + Intronic
999178788 5:149654167-149654189 ATCTGGAGATGGAGATAATAAGG - Intergenic
999941940 5:156552398-156552420 GTGGGGATGTGGAGATACCATGG + Intronic
1001375086 5:171248739-171248761 CTCAGGATGTGGAGATACAAGGG - Intronic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1007500606 6:42293984-42294006 ATCAGGATATTGAGATACTAGGG + Intronic
1007519754 6:42442412-42442434 CTCTGACTTTGGAGATAACAGGG - Intronic
1008639702 6:53449290-53449312 TTCTGTATATGGAAAAACCAAGG - Intergenic
1009192817 6:60650080-60650102 CTTTGGATCTGGTGAGACCATGG + Intergenic
1013708089 6:112863228-112863250 CTCTGGAGAAGAAGAAACCAGGG - Intergenic
1014690980 6:124563521-124563543 CTGTGGACATGGAAATAGCAGGG - Intronic
1015000699 6:128210764-128210786 TTATACATATGGAGATACCATGG - Intronic
1015035563 6:128650059-128650081 CTCTGGATATTCAGATAGGAAGG + Intergenic
1015502475 6:133948688-133948710 GACTGGGTATGGAGAAACCAGGG - Intergenic
1019906115 7:4066516-4066538 CTATGGCTATAGAGAGACCATGG + Intronic
1020526895 7:9273566-9273588 CTCATGATATGTAGATAACATGG - Intergenic
1020948264 7:14643472-14643494 CTATGGATGTGGAGATACAGGGG - Intronic
1021489820 7:21207480-21207502 CTCTAGAAATGGAGGTGCCATGG - Intergenic
1029043486 7:97601952-97601974 CTCTTGATATGGAAGTATCAAGG + Intergenic
1029192813 7:98783763-98783785 TTGTGGATTTGGAGAGACCAAGG - Intergenic
1030432914 7:109474794-109474816 CTGTGGATTTGGAAATGCCAGGG + Intergenic
1031338275 7:120565631-120565653 CTCTGGACACAGAGATTCCATGG + Intronic
1032356465 7:131215737-131215759 CTGTGATGATGGAGATACCATGG + Intronic
1038354838 8:26818364-26818386 CTTTGGATAGTGACATACCATGG - Intronic
1039934506 8:42030059-42030081 CTACGGATATGGAGATTCAAGGG + Intronic
1042438877 8:68801398-68801420 TTCTGGATTGGGAGAAACCATGG - Intronic
1044563320 8:93636029-93636051 GTCTGGAAATGGAAATAGCAAGG + Intergenic
1045105809 8:98891513-98891535 CTCTTGATATGTACATAGCAGGG + Intronic
1049465966 8:142751471-142751493 CTCTTGCTATGAAGATGCCAGGG - Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052842593 9:33305723-33305745 TTTTGGAAATGGTGATACCAAGG + Intronic
1053011954 9:34638530-34638552 CTCTGGAAATGGAGTTGGCAGGG + Intronic
1054751795 9:68914801-68914823 CTCTGGGTTTGTGGATACCAAGG - Intronic
1056821195 9:89843217-89843239 GTATTGATATGGAAATACCATGG + Intergenic
1056840452 9:89994664-89994686 GACTGGACATGGAGATACTAAGG - Intergenic
1059957292 9:119531406-119531428 CTCTAGACATGCAGATACAATGG + Intergenic
1062730146 9:138104090-138104112 TTCTGGGCATGGAGAGACCAAGG + Intronic
1188416920 X:29946341-29946363 CTCTGCATGTTGAGATCCCATGG - Intronic
1195240863 X:102950478-102950500 CTGTTGATAGGGAGATAACAAGG - Intergenic
1196039618 X:111188129-111188151 CCCAGGATATTGAGATTCCAGGG + Intronic
1197886455 X:131223045-131223067 CTCTGACTTTGGAGGTACCAAGG - Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic