ID: 1164747988

View in Genome Browser
Species Human (GRCh38)
Location 19:30629971-30629993
Sequence TCCACTCCCTTGTTTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 256}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164747976_1164747988 26 Left 1164747976 19:30629922-30629944 CCCCGTGCCATCCAAAACCACCA 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747986_1164747988 -7 Left 1164747986 19:30629955-30629977 CCCATTTGTGGGCAGCTCCACTC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747987_1164747988 -8 Left 1164747987 19:30629956-30629978 CCATTTGTGGGCAGCTCCACTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747983_1164747988 6 Left 1164747983 19:30629942-30629964 CCAGGAGAGAACACCCATTTGTG 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747978_1164747988 24 Left 1164747978 19:30629924-30629946 CCGTGCCATCCAAAACCACCAGG 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747977_1164747988 25 Left 1164747977 19:30629923-30629945 CCCGTGCCATCCAAAACCACCAG 0: 1
1: 0
2: 3
3: 8
4: 145
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747982_1164747988 9 Left 1164747982 19:30629939-30629961 CCACCAGGAGAGAACACCCATTT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747981_1164747988 15 Left 1164747981 19:30629933-30629955 CCAAAACCACCAGGAGAGAACAC 0: 1
1: 1
2: 0
3: 41
4: 284
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256
1164747980_1164747988 19 Left 1164747980 19:30629929-30629951 CCATCCAAAACCACCAGGAGAGA 0: 1
1: 0
2: 1
3: 31
4: 302
Right 1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG 0: 1
1: 0
2: 2
3: 37
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164747988 Original CRISPR TCCACTCCCTTGTTTCTGCC AGG Intronic
900126945 1:1072903-1072925 TCCTCACCATTATTTCTGCCCGG - Intronic
900775819 1:4584783-4584805 TCCACTTCCTTTGTTCTGCCTGG - Intergenic
902659400 1:17890765-17890787 CCCACTCCCTCGCTTCTGCTGGG - Intergenic
903338086 1:22637969-22637991 TCCACTCCCTGTGTACTGCCTGG + Intronic
904290174 1:29479957-29479979 TTCCCTCCCTTTTTCCTGCCTGG + Intergenic
905396255 1:37668622-37668644 TCCTCTCCCTTCTCCCTGCCTGG - Intergenic
905816567 1:40955492-40955514 GCCACTCCCTTCTTTTTGCCTGG + Intergenic
906947948 1:50311453-50311475 TTCAATCCTTTGTTTCTCCCAGG + Intergenic
908023022 1:59917777-59917799 GCCCCTGCCTTTTTTCTGCCTGG + Intronic
909046793 1:70720463-70720485 TCCACTACCTTCTTCCTGGCTGG - Intergenic
909271536 1:73628756-73628778 TCCACTCCTGTGGCTCTGCCGGG + Intergenic
909374468 1:74924101-74924123 TCCACTCTGTTGTTGCTGGCTGG - Intergenic
910446102 1:87300202-87300224 TGCCCTCCCTGGTTTCTACCAGG + Intergenic
911712749 1:101094489-101094511 TCCACTCTCTTCTTGCTGCGTGG + Intergenic
911898929 1:103475650-103475672 TACCCTCCCTTGTTTCTTTCAGG - Intergenic
912022276 1:105120193-105120215 TTCACTGTCTTGTTTCTTCCAGG + Intergenic
912105772 1:106272687-106272709 TACACACCCTTGATTCTGACTGG + Intergenic
912323775 1:108738696-108738718 TCCACTCCCTGTTCTCTGCCTGG + Intronic
913009396 1:114668588-114668610 TACATTTCCTGGTTTCTGCCTGG + Intronic
913371365 1:118103213-118103235 TCCAATCCCCTTTTTCTGTCTGG - Intronic
914684452 1:149965877-149965899 TCCACTATCTTGTTTCTACAGGG - Exonic
915030883 1:152879630-152879652 TCCACTGTCTTCCTTCTGCCTGG - Intronic
915075627 1:153306429-153306451 TGCCCTCCCTTGTTTCTTGCGGG + Intronic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915567404 1:156723284-156723306 TCCACTGCCCTGTTTCTCCTGGG + Exonic
916832313 1:168505542-168505564 TTCATTCCCTGCTTTCTGCCAGG - Intergenic
916842317 1:168613213-168613235 TCCACTGTCTGCTTTCTGCCAGG + Intergenic
917518288 1:175726966-175726988 TTCAAGCCCTTGTTTCTGCTTGG - Intronic
917626569 1:176852465-176852487 TCCACTACTTTGTTTCTTCTTGG - Intergenic
917685756 1:177414173-177414195 TCAACTCCCATGGTTCTGCTAGG - Intergenic
917969522 1:180197871-180197893 TCCCCTCCCTAGCTTCTACCTGG - Exonic
918243796 1:182642040-182642062 TCCACTCCCTTCCCTCTGCCAGG - Intergenic
919071163 1:192756672-192756694 TCTAGTCCTTAGTTTCTGCCTGG + Intergenic
920257712 1:204667180-204667202 TGCACTCCTTTGTGTGTGCCTGG - Intronic
921099711 1:211917957-211917979 TCAAGTCCCTTTTTTCTTCCTGG + Intergenic
921815142 1:219555109-219555131 TCCAAACCATTGTTTCTCCCAGG - Intergenic
924429273 1:243982933-243982955 TTCCCTCCGTTGTATCTGCCTGG - Intergenic
1063942719 10:11147108-11147130 CCCACTCCCTTGTGCCTGCCAGG + Intronic
1066441094 10:35439807-35439829 GCCACTCCCTTGTTACTGCCAGG + Intronic
1068884428 10:62083833-62083855 CCCAATTCCTTTTTTCTGCCTGG - Intronic
1069994954 10:72336347-72336369 TCCACTCCTGTGTTTCTCCGGGG - Intronic
1072748897 10:97962198-97962220 CTCCCTCCCTTTTTTCTGCCTGG - Intronic
1072853803 10:98925405-98925427 GGCACTGCTTTGTTTCTGCCAGG + Intronic
1072977446 10:100071358-100071380 TCCCCTTCTTTGTTTCTTCCAGG + Intronic
1073551960 10:104411590-104411612 TCCATTCATTTGTTTCTGCCAGG + Intronic
1074960617 10:118442031-118442053 TTCAGTCCCTTGTTTCTCACAGG - Intergenic
1075142124 10:119848242-119848264 TCCCCTGCCTTGCTTCTACCAGG - Intronic
1076146524 10:128126411-128126433 TCCACTTCCTTCTTCCAGCCCGG + Intergenic
1076449130 10:130544195-130544217 TTCACTCCATTCTCTCTGCCTGG + Intergenic
1076891955 10:133289206-133289228 TCCACACCCTTGCTCCTTCCCGG + Intronic
1078744330 11:14096731-14096753 TGCACTCCTTTGACTCTGCCAGG + Intronic
1081410541 11:42752675-42752697 TCCCCTTCCTTGTTTTTGTCAGG + Intergenic
1084601255 11:70147241-70147263 TCCATTCCCTGGTCTCTGCCTGG - Intronic
1085168825 11:74429939-74429961 TCCACTCTTTTTTTTCTGCTAGG + Intergenic
1085179506 11:74521682-74521704 TCCACTTCAGTGTTTCTTCCAGG - Intronic
1085309721 11:75509020-75509042 TCCACTTCCCTGTTCATGCCAGG - Intronic
1086602419 11:88650537-88650559 TCCACACCCTTGTTAATACCTGG - Intronic
1086843625 11:91720315-91720337 TCTACTCTATTGTTTTTGCCTGG + Intergenic
1087909356 11:103735434-103735456 TCAACTCTCTTCTTTCTACCTGG + Intergenic
1088113527 11:106290250-106290272 TCCCCTCCCTTCTTCCTGTCAGG + Intergenic
1090846906 11:130537114-130537136 TCCACTTCATTGTTGCTGCAGGG + Intergenic
1092910602 12:13141665-13141687 TCCACTGCATTATTACTGCCAGG + Intronic
1094036923 12:26081722-26081744 TCCACCCCCATGGTTCTGCAGGG + Intergenic
1095410706 12:41918505-41918527 TCCCCTACCTTGTTCCTCCCAGG + Intergenic
1096511749 12:52133825-52133847 TCCACTCTCCAGATTCTGCCTGG - Intergenic
1097705003 12:62859143-62859165 ACCCCTCCCCTGTTTCTTCCAGG - Intronic
1098851762 12:75604451-75604473 TTCACTTTCTTGTTTCTGCAGGG - Intergenic
1099213924 12:79830794-79830816 TGCCTTCCCTTGTTTCTGTCTGG - Intronic
1099395316 12:82131453-82131475 TGCACTCCCTTCTTTCTGTCTGG - Intergenic
1101742267 12:107509945-107509967 TCGACTCCCTTCTCTGTGCCAGG + Intronic
1103012645 12:117469122-117469144 TCCTCCCCCTTGTTTCTGGCTGG - Intronic
1103575300 12:121872894-121872916 TCCAGGAGCTTGTTTCTGCCTGG - Intergenic
1104760985 12:131297446-131297468 TGCACTCCCACGGTTCTGCCTGG - Intergenic
1104818793 12:131663346-131663368 TGCACTCCCACGGTTCTGCCTGG + Intergenic
1105213412 13:18271123-18271145 TCCACACCCCTCTTTCTGCAGGG + Intergenic
1105427733 13:20309336-20309358 TCCCCTCCTTTAATTCTGCCAGG - Intergenic
1106609456 13:31264459-31264481 TCCTCTCCCTTTCCTCTGCCAGG + Intronic
1110600122 13:77363448-77363470 TACACTCTGTTGTTTCTGTCAGG - Intergenic
1110850464 13:80239218-80239240 TCCACCCCCTAATTTCTTCCTGG + Intergenic
1112094890 13:96121612-96121634 TCCAGTCCATGGTTTCTTCCTGG + Intronic
1115301734 14:31892901-31892923 TTCCCTCCCTTTATTCTGCCAGG + Intergenic
1119032339 14:71202573-71202595 ACCACTCCCTTCTTTTTGCCTGG - Intergenic
1119099689 14:71868402-71868424 TCCAGTCCCTGCTTTCTGCTGGG - Intergenic
1119278373 14:73381923-73381945 TCCACTGCTTTGTTTCTGCTGGG + Intronic
1119741129 14:77014336-77014358 CCCCCTCCCCTGTGTCTGCCTGG - Intergenic
1120020252 14:79522105-79522127 TCAATTCCATTGATTCTGCCTGG - Intronic
1121334456 14:93069002-93069024 ACTCCTCCCTTGTTTCTGGCCGG - Intronic
1121751478 14:96361798-96361820 TCCTCTCCCTAGTTTATGTCAGG + Intronic
1122628940 14:103098705-103098727 TCCACTCGCTTCTCTCTCCCCGG - Intergenic
1122891263 14:104733283-104733305 TCCACGCCCTGACTTCTGCCTGG - Intronic
1128063149 15:64747816-64747838 TTCACTCCCTGTTTCCTGCCCGG + Intronic
1129742989 15:77999130-77999152 TCCCCTCTCTGGATTCTGCCAGG + Intronic
1129842489 15:78752309-78752331 TCCCCTCTCTGGATTCTGCCAGG - Intergenic
1129892674 15:79081880-79081902 TCCTCTCCCTTGTTAATTCCAGG + Intronic
1130052839 15:80498181-80498203 TGCACTCCCTCCTTCCTGCCTGG + Intronic
1130056847 15:80533449-80533471 TCCATTACCATATTTCTGCCTGG - Intronic
1130095580 15:80853334-80853356 TCCAGTCCCTTCTTGCGGCCTGG - Intronic
1132830351 16:1924929-1924951 TCCTCTCCCTTGGGTCTTCCTGG + Intergenic
1133857154 16:9560346-9560368 GCCACTCCCTTGTTCCCCCCAGG - Intergenic
1135874203 16:26182474-26182496 TCGAGTCCTTTGTATCTGCCAGG - Intergenic
1136046964 16:27622720-27622742 TCTCCTTCCTTCTTTCTGCCTGG - Intronic
1136047197 16:27624111-27624133 TCTCCTTCCTTCTTTCTGCCTGG + Intronic
1136684948 16:31988614-31988636 CCTACTCCCTGGTTTCTGCCAGG - Intergenic
1136785564 16:32932149-32932171 CCTACTCCCTGGTTTCTGCCAGG - Intergenic
1136884209 16:33921655-33921677 CCTACTCCCTGGTTTCTGCCAGG + Intergenic
1139046580 16:63067603-63067625 TCCAAGCTCTTATTTCTGCCTGG + Intergenic
1142021440 16:87785372-87785394 GCCACTCCCTGGTTTCTGATGGG + Intergenic
1142066877 16:88067818-88067840 CCCACTCCATTGTTCCTGCATGG + Intronic
1142263600 16:89053664-89053686 GCCACTCCCTTGGCTCTTCCTGG - Intergenic
1142720224 17:1771007-1771029 TCCACATCCTTGTCTCTGGCAGG + Exonic
1142885560 17:2910289-2910311 TCCACTCCTCTGCTTCTGGCTGG + Intronic
1143131798 17:4683079-4683101 TCCACACCCTCTTTTCTGCCAGG - Intronic
1144255208 17:13460857-13460879 TACAAGCCTTTGTTTCTGCCAGG - Intergenic
1144874900 17:18392421-18392443 TCCATTCCAGTGTCTCTGCCAGG - Intergenic
1145157325 17:20552000-20552022 TCCATTCCAGTGTCTCTGCCAGG + Intergenic
1146779341 17:35653851-35653873 CCCAGTCCCTTGTTGCTGTCAGG + Intronic
1146791535 17:35753337-35753359 CCCTCTCCCTTGGTTCTGCAGGG - Intronic
1147736063 17:42639195-42639217 TCTGCTCCCTTCTTTCTGCTAGG - Intergenic
1149937276 17:60820391-60820413 TCCAGCCCCTAGTTTCTGACTGG - Intronic
1151443767 17:74150206-74150228 TCAACGCCCCTGCTTCTGCCTGG - Intergenic
1158981752 18:62769311-62769333 TGTAATCCCTGGTTTCTGCCAGG + Intronic
1159754519 18:72348052-72348074 GGCACTCCTGTGTTTCTGCCCGG - Intergenic
1161195964 19:2986956-2986978 CTCACTGCCTTGTTCCTGCCGGG + Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161722391 19:5910302-5910324 TACACTCCCTAGATTCTACCTGG - Exonic
1162389558 19:10381019-10381041 TCCTTTCCCTCGTTTCTACCTGG + Intergenic
1162575686 19:11497511-11497533 TTCACTCCCTTCCTCCTGCCTGG - Intronic
1162974955 19:14203309-14203331 TCCACCCCCTCCTTTCTCCCTGG - Intronic
1163648872 19:18505668-18505690 TCCCCTCCCCTGTGTGTGCCTGG - Intronic
1163825258 19:19519882-19519904 CCCACTCCCTTCTGTCTGCCTGG + Intronic
1164576572 19:29408775-29408797 TCCCCTCCCTTTGTTCTGCAAGG + Intergenic
1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG + Intronic
1164772213 19:30818240-30818262 TCCATCACCTTCTTTCTGCCTGG + Intergenic
1165025652 19:32959258-32959280 CACACTCCCTCGTTTCTGTCTGG + Intronic
1166052113 19:40266429-40266451 TTACCTCCCTTCTTTCTGCCGGG - Intronic
1166561600 19:43736366-43736388 TCCTGTCCCTTCCTTCTGCCTGG + Intronic
1167994131 19:53388961-53388983 ACCACTCTCTTGTATCTGACAGG - Intronic
1168685286 19:58345927-58345949 ACCACTGCCGAGTTTCTGCCTGG - Intronic
927201921 2:20583332-20583354 GCCCCTCCCTGGTTCCTGCCTGG - Intronic
927201940 2:20583410-20583432 GCCCCTCCCTGGTTCCTGCCTGG - Intronic
927674108 2:25091817-25091839 GCCACTCTCTGGTGTCTGCCAGG + Intronic
928060420 2:28107150-28107172 TGCACTCCCTTCACTCTGCCTGG + Intronic
929320147 2:40533231-40533253 TCATCTCCATGGTTTCTGCCAGG - Intronic
929414832 2:41736819-41736841 TCCACTACCTTGTGGCTGCTGGG - Intergenic
929732927 2:44515001-44515023 ACCACTCACTTATTTCTACCAGG + Intronic
930035053 2:47080111-47080133 TCCTCTCTCTTGTCTGTGCCAGG + Intronic
930083703 2:47476831-47476853 TCCACTACCATGTTTTTGCTTGG + Intronic
934300911 2:91775621-91775643 TCCACACCCCTCTTTCTGCAGGG - Intergenic
935615935 2:105082068-105082090 TGCACTCTCTTTGTTCTGCCTGG + Intronic
936892076 2:117383328-117383350 TGCACTCCCATGTTTCTTGCAGG - Intergenic
939636488 2:144589456-144589478 TCCTCTGCCTTGTTTCAACCTGG + Intergenic
940620076 2:156101159-156101181 ACCAGTCACTGGTTTCTGCCTGG - Intergenic
941391158 2:164916627-164916649 TTCACTCCCATGTTTTTTCCAGG + Intronic
944339093 2:198574316-198574338 TCCACTCCTTTGGTTCTGTCAGG + Intergenic
946196459 2:218035259-218035281 TCCTCTCCCTCGTCTCTGCCAGG - Intronic
946200741 2:218069423-218069445 TCCTCTCCCTCGTCTCTGCCAGG - Exonic
946210328 2:218142709-218142731 TGCACTGCCTAGTTTCTGCCAGG - Intergenic
947898065 2:233693886-233693908 TGGACTGCCTTGTTTCTTCCAGG + Intronic
948897943 2:240935889-240935911 TCCTCTGTCTTGTTTCTCCCTGG + Intronic
949077607 2:242070941-242070963 TCTGCTCCCTGGTTTCTGCCTGG + Intergenic
949077624 2:242071030-242071052 TCTGCTCCCTGGTTTCTGCCTGG + Intergenic
1168767093 20:388991-389013 TCCATTTCCTGGTTTCTGCCAGG - Intronic
1169119290 20:3085455-3085477 TCCACACTCATGTTTCTACCTGG - Intergenic
1169275591 20:4231843-4231865 GCCACTCCCTTTGTTCTTCCTGG + Intronic
1170045560 20:12081684-12081706 TCCATTCCTTTGTTTCTGTGTGG + Intergenic
1171146509 20:22788395-22788417 TGCACTCTCTTGTTTCTTCCAGG - Intergenic
1171724382 20:28602854-28602876 TCCACTTCCGAGTTTCTGCTGGG + Intergenic
1171788579 20:29497355-29497377 TCCACTTCCGGGTTTCTGCCAGG + Intergenic
1171858976 20:30377174-30377196 TCCACTTCCAGGTTTCTGCCGGG - Exonic
1171990109 20:31689482-31689504 TACCTTCCCTTGTTTCTTCCAGG - Intronic
1172568246 20:35948026-35948048 CCAACTCCCTGGTTTCTTCCTGG + Exonic
1173270646 20:41531685-41531707 TTCACTCCCTTCTGTCTGGCAGG - Intronic
1173879009 20:46396727-46396749 TCCAGTCACTTGTTTCAGCAGGG - Intronic
1175173247 20:57094134-57094156 TCCCCCCCTTTGTTCCTGCCTGG + Intergenic
1175238411 20:57528231-57528253 TTCGCTCCCTAGTTTCTGCGTGG + Intergenic
1175477462 20:59286972-59286994 TCCACTCCCTTGTCTAGGCTAGG - Intergenic
1176054716 20:63138336-63138358 TCCATGCCCTTGTTTCTGCTTGG - Intergenic
1179805417 21:43834250-43834272 TTCACTTCCTTCCTTCTGCCAGG + Intergenic
1180164515 21:46017052-46017074 GGCACTACCTTGTTACTGCCAGG + Intergenic
1180297930 22:10961528-10961550 TCCACTTCCGAGTTTCTGCTGGG + Intergenic
1180410484 22:12602269-12602291 TCCACTTCCGGGTTTCTGCCGGG - Intergenic
1180701198 22:17782238-17782260 TCCACTCCCTTCCCTCTGCTGGG - Intergenic
1180816244 22:18791523-18791545 TCCACACCCCTCTTTCTGCAGGG + Intergenic
1181202433 22:21225855-21225877 TCCACACCCCTCTTTCTGCAGGG + Intronic
1181699273 22:24610759-24610781 TCCACACCCCTCTTTCTGCAGGG - Intronic
1181992643 22:26849242-26849264 TCATCTCCCATCTTTCTGCCTGG - Intergenic
1182003493 22:26940137-26940159 TTCACTCCTTTGTTTCTTTCAGG - Intergenic
1182003700 22:26941697-26941719 TTCACTCCTTTGTTTCTTTCAGG + Intergenic
1183226539 22:36554039-36554061 TCCCATCCCCTGCTTCTGCCTGG + Intergenic
1184812519 22:46846097-46846119 TAAACTCCATGGTTTCTGCCTGG - Intronic
1203224480 22_KI270731v1_random:69558-69580 TCCACACCCCTCTTTCTGCAGGG - Intergenic
1203266347 22_KI270734v1_random:17234-17256 TCCACACCCCTCTTTCTGCAGGG + Intergenic
950438119 3:12992856-12992878 TCCCCTCCCATGTTTCTGCCAGG - Intronic
954100855 3:48371648-48371670 ACCACTCCCGTGTGTCTGCCTGG + Intergenic
954718087 3:52536848-52536870 TCCACTCCATCGTTCCTCCCAGG - Exonic
955580278 3:60412418-60412440 TCATCTCCCTTCTGTCTGCCAGG + Intronic
959581146 3:107983842-107983864 TCAACTCTCCTGCTTCTGCCTGG + Intergenic
961019873 3:123496533-123496555 TCCACGCCATTGCTACTGCCAGG + Intronic
961115095 3:124322494-124322516 TCCACTCTCTTCCATCTGCCTGG - Intronic
961340556 3:126214196-126214218 TCCATTCCCTGCTTACTGCCCGG + Intergenic
961496605 3:127297366-127297388 TCCACTGCCTTCTTTCCTCCAGG - Intergenic
963041720 3:141075091-141075113 CTCACTCCCTTGTTTCTGATGGG - Intronic
963217414 3:142764588-142764610 TCCACTCCCTTCTGCCTGCATGG + Intronic
963231966 3:142916896-142916918 TTCATTCCCTGGCTTCTGCCTGG + Intergenic
963310184 3:143700808-143700830 ACCACTCCCTGGCTGCTGCCAGG - Intronic
964305256 3:155332859-155332881 TTAACTCCCGTGTTTCTGGCTGG + Intergenic
970659165 4:18264857-18264879 TCCACTCCTGTGATTCTGCAGGG + Intergenic
970971242 4:21986724-21986746 TACACAACCTTATTTCTGCCTGG + Intergenic
970991244 4:22215855-22215877 TCCCCTCCCATCTTTGTGCCTGG - Intergenic
972180939 4:36464479-36464501 TCCACTCCTTTGTGACTTCCAGG - Intergenic
974596309 4:64017529-64017551 TCCAGTTGCTTGTGTCTGCCTGG + Intergenic
977554640 4:98476404-98476426 TCCACTTACTGGTTTTTGCCTGG + Exonic
977745575 4:100542759-100542781 TCCTCACCTTTCTTTCTGCCTGG + Intronic
978860777 4:113446303-113446325 TCCACCCACTTGATTCTGCCTGG - Intergenic
980585492 4:134809310-134809332 TCCTCTACCTTGCTTCTGTCTGG - Intergenic
981089291 4:140715941-140715963 TTCTCTCCCTTGTTGGTGCCAGG - Intronic
983504505 4:168538274-168538296 TCCACTTCCTTTTTTCTATCTGG + Intronic
984323919 4:178227584-178227606 TCAAATCCATTGTTTCTGCCAGG - Intergenic
985437095 4:189940812-189940834 TCCACTTCCGGGTTTCTGCCGGG - Exonic
985482599 5:125759-125781 TGGACTCCGTTGTTTCTGCAGGG + Intergenic
985854532 5:2414473-2414495 TGCACTTCCCTCTTTCTGCCTGG - Intergenic
986241647 5:5965388-5965410 TTCACTGCCTTGTTCATGCCAGG + Intergenic
986624026 5:9706774-9706796 TCCACTCCCTGGGTGCTGCTGGG + Intronic
987023117 5:13895419-13895441 GCCATTCCCGTGTTTCTGCATGG - Intronic
990598293 5:57332670-57332692 TCCACCACTTTCTTTCTGCCAGG - Intergenic
992324823 5:75650408-75650430 TCCACTTCCTTGTCTCTTACAGG - Intronic
993735927 5:91476952-91476974 TCCACACCTTGGTTTCTGTCTGG - Intergenic
994172025 5:96668502-96668524 TTCACTCCCTTCTTTTTCCCTGG - Intronic
995411413 5:111861249-111861271 TCCCCTCCCTAATTTCTGCTTGG + Intronic
1000179496 5:158794234-158794256 GCCACTGCCTTGTGTGTGCCAGG - Intronic
1001692690 5:173644592-173644614 TGCCCTCCTTTGTTTCTCCCCGG - Intergenic
1002451451 5:179321362-179321384 TCCACTCCCTTGCCTCTCACTGG + Intronic
1003058422 6:2842947-2842969 TCCACTCCCATGGATTTGCCAGG + Intergenic
1003968664 6:11277969-11277991 TCCACTCCCTGGCTTCTCACTGG + Intronic
1004745728 6:18507326-18507348 TCTAGTCCCTAGTTCCTGCCAGG + Intergenic
1006795199 6:36727754-36727776 CCCACTCCCTCTTTTCTCCCAGG + Intronic
1011431629 6:87293583-87293605 TCCACTCCTTTGTTTATTACTGG + Intronic
1011908775 6:92409056-92409078 TCCACTTCCTTCTATCTGCATGG + Intergenic
1012501198 6:99889666-99889688 CCCATCCCCTTCTTTCTGCCTGG - Intergenic
1012840643 6:104325029-104325051 TCGTCTCCCTTCTTTCTCCCTGG - Intergenic
1013069322 6:106714254-106714276 TCCACTCCCAAGTTTCAGGCTGG + Intergenic
1013156286 6:107493316-107493338 TACATTCCTTTCTTTCTGCCGGG - Intronic
1014227538 6:118864878-118864900 TGCAGCCCCTTCTTTCTGCCTGG + Intronic
1016539626 6:145150035-145150057 TGCACTCCATTGTTTCTGCTAGG + Intergenic
1017914587 6:158821358-158821380 TCCACTGCCTTATCACTGCCTGG + Intergenic
1018152778 6:160955905-160955927 TTGACTCCCTGTTTTCTGCCAGG + Intergenic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1019632143 7:2055186-2055208 TTCACTCCCTGCTTTCTGTCAGG - Intronic
1020273888 7:6613684-6613706 TCCACTGGCTTCTTTCTGACAGG - Intergenic
1022998016 7:35778381-35778403 TCCACTCCATTCTTGCAGCCTGG - Intergenic
1023466513 7:40461775-40461797 TCCACTCCTTCCTTTCTCCCTGG - Intronic
1023883338 7:44334094-44334116 CTCGCTCCGTTGTTTCTGCCAGG - Intronic
1024441892 7:49429324-49429346 TCCACTACATGGCTTCTGCCTGG + Intergenic
1029598547 7:101550567-101550589 TTCACTCCCTGGTGTCTGTCAGG + Intronic
1032742616 7:134753979-134754001 TCCAGTCCCTTCTCTCTGGCAGG + Intronic
1033063302 7:138128612-138128634 TGCACTCCCTTGCTCCTGCCTGG - Intergenic
1035536163 8:392826-392848 TCTGCTCCGTGGTTTCTGCCTGG + Intergenic
1036756036 8:11471750-11471772 TCCACTCCCTCCTTTCCACCTGG + Intronic
1038754524 8:30328225-30328247 ACCATTCCCTTCATTCTGCCAGG + Intergenic
1039474523 8:37832836-37832858 TCCACTCTCTTTGTTCTGACCGG - Intronic
1039892738 8:41695872-41695894 TCCACTCCCTTGAAGCAGCCTGG - Intronic
1042664934 8:71194327-71194349 TCCACTGCATTGTTTTGGCCAGG - Intergenic
1042670898 8:71262363-71262385 CCCACTCCCTCTTTGCTGCCTGG + Intronic
1044104967 8:88193098-88193120 TACACTCCCTTGTTTATTGCAGG + Intronic
1045491300 8:102671329-102671351 TCCACTCCCTTCTCTGTCCCTGG + Intergenic
1048495949 8:134936352-134936374 TACATTCCCTTCTTTATGCCTGG + Intergenic
1049529195 8:143145977-143145999 TTCACTCCCTTGATTGAGCCTGG + Intergenic
1050121156 9:2308654-2308676 TTCAGTCCCTTGTTTCTTGCAGG - Intergenic
1050667687 9:7959737-7959759 TCCACTCTATTATCTCTGCCTGG + Intergenic
1052681735 9:31701597-31701619 TTCACCCCCTTGTTACTGCGAGG + Intergenic
1053725212 9:40992228-40992250 TCCACTTCCGGGTTTCTGCTGGG - Intergenic
1054340727 9:63859652-63859674 TCCACTTCCGGGTTTCTCCCGGG + Intergenic
1056953082 9:91060999-91061021 TCCACTCCCCTGTTTTTTCCTGG - Intergenic
1057417127 9:94874239-94874261 TCCACTCCCTTTTTTAATCCAGG + Intronic
1058489181 9:105477569-105477591 TCCATTCCCTTATTTCTCCTAGG - Intronic
1061045253 9:128161458-128161480 TCCAAGCCTTTGCTTCTGCCTGG - Intronic
1061263109 9:129490789-129490811 ACCCCTCCCCTGTTTCTGGCAGG + Intergenic
1185552017 X:990077-990099 TCTAGTCCCTAGTTCCTGCCGGG - Intergenic
1185713793 X:2325281-2325303 TCTAGTCCCTAGTTCCTGCCCGG - Intronic
1185713801 X:2325330-2325352 TCTAGTCCCTAGTTCCTGCCGGG - Intronic
1185713810 X:2325379-2325401 TCTAGTCCCTAGTTCCTGCCGGG - Intronic
1186104449 X:6191362-6191384 TCCAGTCCCTTGTTCCACCCAGG - Intronic
1187603811 X:20861748-20861770 TCCACTCCTCTGGTTCTGCAGGG - Intergenic
1188752119 X:33917646-33917668 ACAATTCCCTTCTTTCTGCCAGG - Intergenic
1188978931 X:36708715-36708737 TCCACTTCCGTGTTTCTGAGTGG - Intergenic
1190503903 X:51106645-51106667 TAAAATCCCTTGTTTTTGCCTGG - Intergenic
1192361035 X:70439598-70439620 GCCACTGCCTGGTTACTGCCGGG - Intergenic
1193667522 X:84340174-84340196 TCCACTCATTTGTTTCTGAGAGG - Intronic
1193740767 X:85214907-85214929 TCCACTCCCATGGTTCTGCTAGG + Intergenic
1194848525 X:98842218-98842240 TCCACTCCCATGTTTATTGCAGG - Intergenic
1195833327 X:109084600-109084622 TCCAATTGCTTGTTTTTGCCAGG + Intergenic
1196553029 X:117052975-117052997 CCCTCTCCCTTGTGTCTTCCAGG - Intergenic
1197705149 X:129629668-129629690 TCCTCTCCCTTGTGTCTGTAAGG + Intergenic
1200088926 X:153625467-153625489 TCTCCTCCCTTGGCTCTGCCAGG - Intergenic
1200856173 Y:7940842-7940864 GCGACTCTCTTTTTTCTGCCTGG - Intergenic
1201133987 Y:10976522-10976544 TCCACTCCTTTCTTTCCACCGGG + Intergenic