ID: 1164750345

View in Genome Browser
Species Human (GRCh38)
Location 19:30649097-30649119
Sequence GCCCGACAGCTGCCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164750343_1164750345 -9 Left 1164750343 19:30649083-30649105 CCACCTCACTGTATGCCCGACAG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG 0: 1
1: 0
2: 0
3: 25
4: 224
1164750341_1164750345 5 Left 1164750341 19:30649069-30649091 CCCTGGGTCTTGAGCCACCTCAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG 0: 1
1: 0
2: 0
3: 25
4: 224
1164750340_1164750345 15 Left 1164750340 19:30649059-30649081 CCAGGATCAACCCTGGGTCTTGA No data
Right 1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG 0: 1
1: 0
2: 0
3: 25
4: 224
1164750342_1164750345 4 Left 1164750342 19:30649070-30649092 CCTGGGTCTTGAGCCACCTCACT 0: 1
1: 0
2: 3
3: 21
4: 197
Right 1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG 0: 1
1: 0
2: 0
3: 25
4: 224
1164750337_1164750345 25 Left 1164750337 19:30649049-30649071 CCATAGTTAACCAGGATCAACCC 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG 0: 1
1: 0
2: 0
3: 25
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164750345 Original CRISPR GCCCGACAGCTGCCCCAGAC AGG Intronic
900134689 1:1110922-1110944 GCCCGCCTGCCGCGCCAGACAGG - Intronic
900557554 1:3287929-3287951 GCCATGCAGCTGCCCCAGCCGGG - Intronic
902291818 1:15440370-15440392 GCCCCACAGCTGGCCCTGGCAGG + Exonic
902294490 1:15457153-15457175 GCCCAACAGCTGGCCCTGGCAGG + Exonic
902297313 1:15476524-15476546 GCCCAACAGCTGGCCCTGGCAGG + Exonic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
904612512 1:31733225-31733247 GCTCTTCAGCTGCCCAAGACTGG + Intronic
905192189 1:36243943-36243965 GCCCGCCAGCCGCCCCATCCGGG - Intronic
905673466 1:39808331-39808353 GCCCGGCAGCTGCCCCGTCCAGG + Intergenic
905699355 1:39999921-39999943 GCCCGGCAGCCGCCCCATCCGGG + Intergenic
906691869 1:47798077-47798099 GCCTGAGAGCTTCCTCAGACTGG + Intronic
907179085 1:52553645-52553667 GCCCCAGTGCTGCCCCAGTCTGG + Intergenic
910815717 1:91289059-91289081 GCCCGGCAGCCGCCCCATCCGGG - Intronic
911788087 1:101976348-101976370 CCTGGACAGCTGCCCGAGACTGG + Intronic
912355796 1:109053486-109053508 GCCCGGCAGCTGCCCCGTCCAGG + Intergenic
912844021 1:113063575-113063597 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
912881932 1:113424051-113424073 GCCCAGCAGCAGCTCCAGACTGG - Intronic
914908983 1:151769346-151769368 GCCCGGCAGCTGCCCCGTCCGGG - Intronic
917553312 1:176058053-176058075 GCCCGGCAGCCGCCCCGGCCGGG + Intronic
918066499 1:181105313-181105335 GCCCGAGAGCAGGCCCAGGCGGG + Intergenic
918172491 1:182011025-182011047 GCCCGGCAGCTGCCCCGTCCAGG + Intergenic
918522209 1:185427230-185427252 GTCCTACAGCAGCCCAAGACTGG - Intergenic
918812484 1:189139812-189139834 GCCCGGCAGCTGCCCCATCCGGG - Intergenic
921109101 1:212015060-212015082 GCCCGGCAGCCGCCCCATCCGGG + Intronic
921174895 1:212585204-212585226 GCCCCAGAGCTGCCACACACAGG - Intronic
922789678 1:228304490-228304512 CCCCGGCATCTGCCACAGACAGG - Exonic
923298610 1:232619608-232619630 GCCTGACAGCTACCCAGGACGGG + Intergenic
1065962303 10:30743645-30743667 GTCCCACAGCTGCCCCATTCTGG + Intergenic
1068069939 10:52183228-52183250 GCCCGTGGGCTGCCCCAGGCAGG - Intronic
1068673247 10:59744420-59744442 GCCCGGCAGCTGCCCCTTCCGGG + Intergenic
1070547588 10:77464745-77464767 CCTTGACAGCTGACCCAGACTGG + Intronic
1070796633 10:79220536-79220558 GGCGGACAGGTGGCCCAGACTGG - Intronic
1071757591 10:88561016-88561038 GCACCACAGGTGCCACAGACAGG + Intronic
1073045252 10:100633982-100634004 GCCAGTCACCTGCCCCAGAATGG + Intergenic
1074361492 10:112827146-112827168 GCCCGAGAGCTGCTCCAGAGTGG + Intergenic
1075709213 10:124521695-124521717 ACCCGCCAGCTGCCCCAGCCTGG - Intronic
1075747311 10:124736766-124736788 GACACACAGCGGCCCCAGACAGG + Intronic
1076015573 10:127024871-127024893 GCCCGGGAGCTGCTCCAGGCAGG + Intronic
1076945502 10:133646378-133646400 GCCCAACACCAGCTCCAGACAGG - Intergenic
1077601945 11:3580594-3580616 CCCAGACAGATGCCCCAGACAGG + Intergenic
1077672177 11:4166793-4166815 ACCCCACTGCTGCCCCAGAATGG + Intergenic
1079109089 11:17594039-17594061 GCCCGCCAGCTGGCCCTGAAAGG - Exonic
1083120822 11:60510441-60510463 GCCCGGCAGCTGCCCCATCTGGG + Intergenic
1084257857 11:67955140-67955162 CCCAGACAGATGCCCCAGACAGG + Intergenic
1084483716 11:69436229-69436251 GCCCGTCAGTGGCCCCAGGCTGG - Intergenic
1084814906 11:71640097-71640119 CCCAGACAGATGCCCCAGACAGG - Intergenic
1084839213 11:71831466-71831488 GCCCGGCAGCCGCCCCATCCGGG + Intergenic
1085208117 11:74749211-74749233 GCCCGACGGCGGGCCCAGCCTGG - Exonic
1085443348 11:76582589-76582611 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1086645047 11:89209709-89209731 GGCCGACAGCTGCCTCATACAGG + Intronic
1089647142 11:119887800-119887822 CCCTGACAGTTGCCCCAGTCAGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1092428091 12:8389937-8389959 CCCAGACAGATGCCCCAGACAGG + Intergenic
1097185486 12:57194283-57194305 GGCTGGCAGCTGCCCCAGTCGGG + Intronic
1097228627 12:57495275-57495297 GCCCGGCAGCCGCCCCATCCAGG - Intronic
1098379418 12:69853185-69853207 GCCCGGCAGCTGCCCCGTCCGGG - Intronic
1102463073 12:113112209-113112231 GCCCGTCAGCAGCCCCAGGCTGG + Exonic
1105017687 12:132796044-132796066 GCCCTGCAGCTCCCCCAGCCTGG + Exonic
1106327664 13:28709789-28709811 GCCAGAGAGATGCCCCAGATAGG - Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108541677 13:51452300-51452322 GCCCGGCAGCTCCCGCAGTCAGG + Intronic
1111107505 13:83666740-83666762 GCCCGACAGTTTCCCCAGATTGG + Intergenic
1113156795 13:107332524-107332546 GCCCCACAGCTGCTCCTGAGGGG - Intronic
1113618352 13:111696612-111696634 GCCTGACCCCTGCCTCAGACTGG + Intergenic
1113789351 13:113019351-113019373 GCCCGACGGCTGCTCCAACCTGG + Intronic
1114344394 14:21780554-21780576 CCGCAACAGCTGCTCCAGACAGG - Intergenic
1114594312 14:23898476-23898498 GCCCGGCAGCTGCCCCATCTGGG - Intergenic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1118808866 14:69259828-69259850 GCCCGGCAGCTGCCCCCGCGCGG - Intronic
1118955585 14:70477690-70477712 GCCCGGCAGCTGCCCCATCTGGG + Intergenic
1118955604 14:70477732-70477754 GCCCGGCAGCTGCCCCGTCCGGG + Intergenic
1119506353 14:75176372-75176394 GGCCGCCAGCGCCCCCAGACTGG + Exonic
1119549318 14:75496933-75496955 GCTGGACAGCTCCCACAGACAGG - Intergenic
1119568149 14:75646326-75646348 GCCAGGCAGCTGCTCCAGCCAGG + Intronic
1202919524 14_KI270723v1_random:18181-18203 GCCCAACACCAGCTCCAGACAGG - Intergenic
1124149605 15:27165802-27165824 GTATGACAGGTGCCCCAGACAGG - Intronic
1124826200 15:33098288-33098310 GCCTGACATCTCCCCCAGTCCGG - Intronic
1125754392 15:42053067-42053089 GCCCCCCAGATGCCCCGGACAGG - Intergenic
1125861612 15:43005304-43005326 GCCCGGCAGCCGCCCCATCCGGG + Intronic
1126573199 15:50172941-50172963 GCCCGGCAGCCGCCCCATCCGGG + Intronic
1127088778 15:55447056-55447078 GCCCGTCAGCTGCCCCATCTGGG - Intronic
1127734921 15:61831240-61831262 GCCCAGCGGCTGCCCCACACTGG - Intergenic
1129159171 15:73737693-73737715 CCCCTGCAGCTGCTCCAGACCGG + Exonic
1130654137 15:85780192-85780214 GCCCAGCTGCTGCACCAGACGGG + Intronic
1131001417 15:88941906-88941928 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1133019711 16:2961975-2961997 GGCCGACCCCTGCCCCAGTCTGG + Intergenic
1133156901 16:3881564-3881586 GCCTCGCAGGTGCCCCAGACAGG + Intergenic
1133370147 16:5240433-5240455 CCCAGACAGATGCCCCAGACAGG - Intergenic
1134072514 16:11269444-11269466 CCCTGAGAGCTGCCCCAGCCTGG - Intronic
1135694301 16:24574130-24574152 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1137289688 16:47043464-47043486 TCCTAACAGCTGCCCCAGCCTGG - Intergenic
1137439064 16:48483160-48483182 GCCCGGCAGCTGCCCCGTCCAGG - Intergenic
1138094221 16:54199566-54199588 GCTTTAGAGCTGCCCCAGACAGG + Intergenic
1138925232 16:61581957-61581979 CCACAACAGCTGCTCCAGACAGG + Intergenic
1139844419 16:69909464-69909486 GCCTGACAGCTGAACCAAACAGG - Intronic
1141503807 16:84462052-84462074 GACCGCCAGCTGCCCCAGGATGG - Exonic
1141695746 16:85618348-85618370 GCCCGCCACATGCCCCTGACGGG + Intronic
1141856347 16:86683682-86683704 ACCCGAGAGATGCCCCAGCCTGG - Intergenic
1142124373 16:88402844-88402866 GGCCAACCGCTGCCCCAGCCTGG - Intergenic
1142126368 16:88412577-88412599 GTCCTAGAGTTGCCCCAGACTGG + Intergenic
1142705253 17:1689853-1689875 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1147644219 17:42024168-42024190 CCCTTCCAGCTGCCCCAGACAGG + Exonic
1147649132 17:42051978-42052000 CCCCCACAGCTGCCCCCGAGTGG + Intronic
1151894723 17:76972298-76972320 GCCCCATACCTGCCCCAGGCTGG + Intergenic
1151946553 17:77323003-77323025 GCCCTACAGCTGCCCAGGAAGGG + Intronic
1151995534 17:77606469-77606491 GCCCGAGAGATGTCCCAGTCAGG + Intergenic
1154089634 18:11344835-11344857 GCCCAGCAGCTGCCCCATCCGGG + Intergenic
1154990249 18:21592668-21592690 GCCCGGCAGCTGCCCCGTCCGGG - Intronic
1155956482 18:31960408-31960430 GCCCGGCAGCTGCCCCGTCCGGG + Intergenic
1156779791 18:40837665-40837687 GCCAGACACCTGCTCCAGAAGGG + Intergenic
1157425665 18:47582310-47582332 GCCAGACAGCAGGCCCAGGCTGG - Intergenic
1159458421 18:68693205-68693227 GCGCAGCAGCTGCTCCAGACGGG - Intronic
1161459151 19:4386216-4386238 GCCCCACAGCTGACTCAGGCAGG - Intronic
1161678151 19:5664760-5664782 GCCGCACAGCTGACTCAGACAGG + Intronic
1161790203 19:6355545-6355567 GCCCGACAGCCACCCCACCCGGG + Intergenic
1162022506 19:7874219-7874241 GCCCGACCCCTCCCCCAGCCGGG + Intronic
1162602081 19:11676918-11676940 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
1163114664 19:15181571-15181593 GCCCGACTGCAGCCCCAGGTGGG - Exonic
1163712255 19:18853822-18853844 GCCTTACAGCTGCCCCACTCTGG - Intronic
1164244694 19:23419452-23419474 GCCCGGCAGCTGCCCCGTCCAGG + Intergenic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1166191623 19:41180350-41180372 GCCCGGCAGCCGCCCCGGCCGGG + Intergenic
1168645990 19:58059595-58059617 GCCCCACCTCTGCCCCACACCGG + Intronic
928722163 2:34133157-34133179 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
931433344 2:62227495-62227517 TCCTGACAGCTGACCCACACGGG + Intergenic
934243987 2:90292802-90292824 GCCCGACAGCCAGCCAAGACAGG + Intergenic
934264860 2:91504606-91504628 GCCCGACAGCCAGCCAAGACAGG - Intergenic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
937229465 2:120389173-120389195 GCCCGTCAGATGCCACAGAGAGG - Intergenic
938836247 2:135106070-135106092 GCCCGGCAGCCGCCCCATCCGGG + Intronic
940682403 2:156803530-156803552 GCCCGGAAGCTGCTCCAGCCCGG + Intergenic
940777868 2:157903492-157903514 GCCAGAGAGCTGCTCCAGAGGGG - Intronic
943125757 2:183792285-183792307 GCCCGGCAGCTGCCCCATCTGGG - Intergenic
945066239 2:205949793-205949815 GCCCGACACCTGCCTCGGCCAGG - Intergenic
946027368 2:216679859-216679881 GGCCGACAGCTGGCTGAGACCGG + Intronic
946769457 2:223073938-223073960 GCCCTACAGCTGTTCCAGGCTGG + Intronic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
1170664582 20:18375725-18375747 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
1171185873 20:23123680-23123702 GTCCCACAGCTGCCACAGAGTGG + Intergenic
1171783490 20:29442472-29442494 GCCCAACACCAGCTCCAGACAGG - Intergenic
1172059073 20:32176210-32176232 GCCCGGCAGCCGCCCCATCCGGG + Intergenic
1172337913 20:34132643-34132665 GCCCGGCAGCTGCCCCGTCCGGG + Intergenic
1173228036 20:41173429-41173451 GCCCGACATCTGCCAAAGAATGG + Exonic
1175385066 20:58589551-58589573 GGCCCACAGCTGACCCAGAGAGG - Intergenic
1175479523 20:59301426-59301448 GCCTGCCAGCATCCCCAGACTGG - Exonic
1176722044 21:10401229-10401251 GCCCGACAGCCTCCCGAGGCTGG - Intergenic
1177178509 21:17720607-17720629 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1178873142 21:36392565-36392587 GCCCGGCAGCTGCCCCGTCCAGG - Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1181943822 22:26499513-26499535 TCCCAACAGCTGCCACAGTCTGG - Exonic
1182563998 22:31184114-31184136 GCCCGGCAGCTGCCCCGTCCAGG - Intronic
1182653596 22:31872121-31872143 GCCCCACAGCTGGCCCAGTTCGG + Intronic
1183472509 22:38017059-38017081 GCCCCACAGCTGCCTCAGGAGGG - Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184288510 22:43485928-43485950 GCCCGATGGCTGCCCGAGAGGGG - Intronic
1184516363 22:44965177-44965199 GCCTGGCAGCTGCCCTGGACAGG - Intronic
1184771883 22:46601949-46601971 GCCCAAGAGCTGCCCAAGAAGGG - Intronic
950725458 3:14914145-14914167 GCCCGACAGGTGCTCAAGCCAGG + Intronic
951556589 3:23926957-23926979 GACCATCAGCTGCCCCAAACAGG + Intronic
952385198 3:32836111-32836133 CCCCGACAGCTCCCCCAGCAAGG + Intronic
957072784 3:75579628-75579650 CCCAGACAGATGACCCAGACAGG + Intergenic
957081983 3:75644090-75644112 GCCCAACACCAGCTCCAGACAGG + Intergenic
959419168 3:106111405-106111427 GCCCGCCAGCCGCCCCATCCGGG - Intergenic
960770764 3:121190737-121190759 GCCCGGCAGCTGCCCCATCCGGG - Intronic
961281287 3:125767126-125767148 CCCAGACAGATGCCCCAGACAGG - Intergenic
961873086 3:130002456-130002478 CCCAGACAGATGCCCCAGACAGG + Intergenic
962750823 3:138433996-138434018 GCCCCACAGATGGCCAAGACGGG + Intergenic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
966617211 3:181925946-181925968 GCCCGGCAGCTGCCCCGTCCAGG - Intergenic
966903670 3:184506396-184506418 GCCTGTCAGCTGCCCAAGACTGG + Intronic
968175177 3:196543229-196543251 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
968754519 4:2408494-2408516 GCCTGACAGCTGCACCAGCCGGG + Intronic
969016393 4:4106938-4106960 CCCAGACAGATGCCCCAGACAGG + Intergenic
969179259 4:5424505-5424527 TCCCAACATCTGCCCCAGTCTGG - Intronic
969737563 4:9001386-9001408 CCCAGACAGATGCCCCAGACAGG - Intergenic
969796762 4:9532947-9532969 CCCAGACAGATGCCCCAGACAGG - Intergenic
970272798 4:14365297-14365319 GCCCAATAGCAGCCCCAGCCTGG - Intergenic
970472727 4:16393498-16393520 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
972939776 4:44182091-44182113 GCCCGACAGCCGCCCCGTCCGGG + Intronic
974365661 4:60945871-60945893 GCCATACAGCTCTCCCAGACTGG + Intergenic
982182872 4:152765398-152765420 GCCCGGCAGCCGCCCCATCCGGG - Intronic
982723508 4:158882303-158882325 GCCCGGCAGCTGCCCCATCTGGG + Intronic
983628768 4:169828526-169828548 CCCCGCCAGCTGCCCCATCCGGG + Intergenic
985448888 4:190046890-190046912 GCCCAACACCAGCTCCAGACAGG - Intergenic
987838067 5:23186858-23186880 GGCCGACAGATGCCTCATACAGG + Intergenic
990821440 5:59845005-59845027 GGCTGAGAGCTGCCCCAGGCTGG + Intronic
991723650 5:69515654-69515676 GCCCGGCAGCTACCCCATCCGGG - Intronic
996054135 5:118965238-118965260 GCCCGACAGCCGCCCCGTCCGGG + Intronic
997364277 5:133315678-133315700 GCCCTAGAGCTGCACCAGGCAGG - Intronic
1000630208 5:163583703-163583725 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1001424795 5:171616119-171616141 CCCAGCCAGCTGCCCCAGGCAGG + Intergenic
1003831929 6:10021335-10021357 GACCGACAGATGCCTCATACAGG - Intronic
1006064780 6:31454957-31454979 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1006803881 6:36776465-36776487 GGGCCACAGCTGCCCCTGACTGG + Intronic
1007816414 6:44528392-44528414 GCCTCACAGTTGCCCCACACCGG - Intergenic
1009622678 6:66096858-66096880 GCCCGGCAGCCGCCCCATCCGGG - Intergenic
1010386324 6:75284687-75284709 GCCCGCCGGCTGACCCTGACAGG + Exonic
1019186686 6:170224628-170224650 GCCCCACTGCTGCCGCACACAGG + Intergenic
1023272780 7:38483182-38483204 ACCTGACAGCTATCCCAGACAGG - Intronic
1026186188 7:68083484-68083506 GCCCGGCAGCTGCCCCATCTGGG + Intergenic
1028417647 7:90596590-90596612 CCCCGACAACTTCCCCAAACTGG - Intronic
1030124816 7:106143774-106143796 GCCCGAACCCTGCTCCAGACAGG + Intergenic
1032784487 7:135189520-135189542 TGCAGACAGGTGCCCCAGACTGG + Intronic
1033294085 7:140114969-140114991 GCCCGGCAGCCGCCCCATCCGGG + Intronic
1033306835 7:140231245-140231267 GCCCGGCAGCCGTCCCAGGCCGG - Intergenic
1035373486 7:158393543-158393565 GCCCGGCACCTGCTGCAGACCGG + Intronic
1036242656 8:7092648-7092670 CCCAGACAGATGTCCCAGACAGG - Intergenic
1036258151 8:7221381-7221403 CCCAGACAGATGCCCCAGACAGG + Intergenic
1036310200 8:7679977-7679999 CCCAGACAGATGCCCCAGACAGG + Intergenic
1036359336 8:8066126-8066148 CCCAGACAGATGCCCCAGACAGG - Intergenic
1036536747 8:9657798-9657820 GCCCGGCAGCCGCCCCATCCGGG - Intronic
1036830075 8:12014498-12014520 CCCAGACAGATGCCCCAGACAGG + Intronic
1036891620 8:12600826-12600848 CCCAGACTGATGCCCCAGACAGG + Intergenic
1036899159 8:12658791-12658813 CCCAGACAGATGCCCCAGACAGG + Intergenic
1040298233 8:46174347-46174369 CCCCCACAGCTGTCCCAGGCAGG + Intergenic
1040310171 8:46232771-46232793 GCCCCAGAGCTGTCCCAGGCAGG + Intergenic
1040334461 8:46409007-46409029 GCCCCAGAGCTGTCCCAGGCGGG + Intergenic
1040917003 8:52573644-52573666 GCCCGGCAGCTGCCCCATCTGGG - Intergenic
1042134036 8:65616971-65616993 GCCCGGCAGCCGCCCCATCCAGG + Intronic
1043961592 8:86424002-86424024 GCCCGGCAGCTGCCCCGTCCGGG - Intronic
1045021905 8:98051791-98051813 GCCCGGCAGCTGCCCCATCTGGG - Intergenic
1045235791 8:100351486-100351508 GCCCGGCAGCCGCCCCATCCAGG + Intronic
1047240741 8:123085892-123085914 GCCCCACAGATGCCCCAGTTTGG + Intronic
1049082996 8:140457479-140457501 GCCCGGCAGCGGACCCGGACAGG + Intronic
1049562268 8:143317663-143317685 GCACGGCCCCTGCCCCAGACCGG - Intronic
1053104243 9:35396763-35396785 TCCTGACAGCTCCACCAGACTGG - Intronic
1055298019 9:74853289-74853311 GCCCGGCAGCCGCCCCATCCGGG + Intronic
1059544087 9:115158988-115159010 CTCCGACAGCTGGTCCAGACTGG + Intronic
1059879810 9:118677940-118677962 GCCCGGCAGCTGCCCCGTCCGGG - Intergenic
1060596747 9:124853247-124853269 GCGCGAGAGCTGCCCTAGAGTGG + Intergenic
1061157825 9:128875738-128875760 GCCTGAGAGCTACCCCAGAAGGG - Intronic
1061233988 9:129331857-129331879 GCCCTGCCGCTGCCCCAGCCTGG - Intergenic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1062183129 9:135201854-135201876 GCCAGCCAGCAGCCCCAGCCAGG + Intergenic
1062206973 9:135342753-135342775 ACCTGTCAGCTGCCCCAGCCTGG + Intergenic
1062398843 9:136363631-136363653 GCCCCACAGCCGCCTCAGGCAGG + Exonic
1203787834 EBV:137526-137548 GCCCGCCAGCCACCCCAGACAGG + Intergenic
1188086472 X:25906141-25906163 GCCCGGCAGCTGCCCCGTCCGGG + Intergenic
1189257741 X:39653484-39653506 GCCCCAAAGTTGCCCTAGACAGG - Intergenic
1189300193 X:39946974-39946996 CCCTGACAGCTGCCCCATGCAGG - Intergenic
1190820333 X:53967110-53967132 GCCTGGCAGCTGCCCCATCCGGG + Intronic
1191894250 X:65975512-65975534 GCCCGACAGCCGCCCCATCTGGG - Intergenic
1192149755 X:68704994-68705016 GCCTAATATCTGCCCCAGACTGG + Intronic
1192761307 X:74098528-74098550 GCCCGGCAGCTGCCCCATCTGGG + Intergenic
1198189124 X:134285984-134286006 GCCCGGCAGCCGCCCCATCCAGG - Intergenic
1198189133 X:134286024-134286046 GCCCGGCAGCTGCCCCATCTGGG - Intergenic
1199787392 X:151117388-151117410 GCCCCACAGTTGCCCCACTCAGG + Intergenic
1201948278 Y:19535763-19535785 GCCCAGCAGCTGCCCCATCCGGG + Intergenic