ID: 1164753500

View in Genome Browser
Species Human (GRCh38)
Location 19:30672869-30672891
Sequence GTTCCTCGGAGGGTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164753500_1164753505 5 Left 1164753500 19:30672869-30672891 CCTGCTGGGACCCTCCGAGGAAC 0: 1
1: 0
2: 3
3: 13
4: 162
Right 1164753505 19:30672897-30672919 GGACAACCTCAAGAAAGCTGCGG 0: 1
1: 0
2: 2
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164753500 Original CRISPR GTTCCTCGGAGGGTCCCAGC AGG (reversed) Intronic
900487202 1:2928630-2928652 GTGCATCGGGGGCTCCCAGCTGG + Intergenic
902784626 1:18725131-18725153 GTTCCTGGGAGGGGGCAAGCCGG + Intronic
903771010 1:25764300-25764322 GTTCTCGGGAGGGTCCCAGGTGG + Intronic
903817378 1:26074494-26074516 GTGCCCAAGAGGGTCCCAGCTGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
921357573 1:214300283-214300305 GATCCTGGGAGAGTCCAAGCTGG - Intronic
922152638 1:223018653-223018675 CATCCTCGGAGGGTCCCTGCAGG - Intergenic
1064396623 10:14987384-14987406 GATCCTCTGAGAGTCCCAGGAGG + Intronic
1064399415 10:15008765-15008787 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1065200716 10:23310488-23310510 GTTCCCAGGAGGGTCCATGCTGG + Intronic
1067019891 10:42786123-42786145 GTTCCTTGGAAGGGCCTAGCAGG + Intronic
1068999361 10:63245868-63245890 TGTCCTGGGAGGGTCCCAGTGGG - Intronic
1071523443 10:86345006-86345028 GTTCCCTGGAGGGCCCCAGCAGG + Intronic
1072802179 10:98399961-98399983 GTTCCTAGGAGGGCTCCAGTTGG - Intronic
1073587657 10:104726262-104726284 GTTCCTCTAAGGCTCCCAGAGGG - Intronic
1075560572 10:123465394-123465416 CTTCCTCTGAGTGTTCCAGCTGG + Intergenic
1076098858 10:127757581-127757603 TTTGCTGGGAGGGTCCCAGCAGG - Intergenic
1076737781 10:132466416-132466438 GGGCCTCAGAGGGTCTCAGCTGG - Intergenic
1077604630 11:3600552-3600574 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1077734045 11:4769516-4769538 GTACCTCAGAGGGTCACAGATGG + Exonic
1078832216 11:14988569-14988591 GATCCTCTGAGAGTCCCAGGAGG + Intronic
1081872495 11:46389795-46389817 GTTCCTCGCAGGGTGCCGGGTGG - Intergenic
1082666315 11:55980019-55980041 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1083699928 11:64469459-64469481 GTGCCTCGGAGGGCAGCAGCAGG - Intergenic
1084227088 11:67723367-67723389 GGTCCTCTGAGAGTCCCAGGAGG + Intergenic
1084260527 11:67975140-67975162 GGTCCTCTGAGAGTCCCAGGAGG + Intergenic
1084812245 11:71620108-71620130 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1084845217 11:71893502-71893524 GATCCTCTGAGAGTCCCAGGAGG - Intronic
1085781099 11:79409869-79409891 GTCCCTCTGAGGGTCCCAGCAGG + Intronic
1090020381 11:123123172-123123194 GTGCCTGGAAGGGTCACAGCTGG - Intronic
1091218204 11:133916482-133916504 GTACCGGGGAGGCTCCCAGCAGG + Intronic
1092431787 12:8415688-8415710 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1092434738 12:8438308-8438330 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1096575405 12:52549595-52549617 GTTCCTCTGAGAGTCCCACAGGG - Intronic
1102059753 12:109923577-109923599 TTTCCTGGGAGGGTCGGAGCAGG - Intronic
1105817995 13:24054032-24054054 GTTCTTCAGAGTGTCCCCGCAGG - Intronic
1106343633 13:28855007-28855029 GTTTCTCCGAGGTTCCCAGCTGG + Intronic
1106564889 13:30875575-30875597 GTTCCTCTGAAGGTTCTAGCAGG + Intergenic
1109839332 13:67902294-67902316 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1113201219 13:107868317-107868339 GGTCCTCGGAGGAGCCCACCCGG - Intergenic
1117039533 14:51757055-51757077 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1117446011 14:55804528-55804550 GTCCCTAAGAGGGTCCCAGTAGG + Intergenic
1121751706 14:96363207-96363229 CTTCCGAGGAGGGTCCCAACCGG + Exonic
1128868747 15:71136448-71136470 CTGCCTCTGAGGGTCCCAACAGG - Intronic
1130787301 15:87114526-87114548 GCTTCTAGGAGGGGCCCAGCCGG + Intergenic
1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG + Exonic
1132647982 16:1007826-1007848 GTTCCTGGGATGCTCCCACCTGG + Intergenic
1134331065 16:13251590-13251612 GCTCCTCAGAGGGTCCTAGTGGG + Intergenic
1140018616 16:71214743-71214765 GCTCTTCAGAGGGTCCCAGTGGG + Intronic
1140348958 16:74243363-74243385 GTGCCTCAAAGGGTTCCAGCAGG - Intergenic
1141076573 16:81011130-81011152 GTTCCTCGAAGGCCCCAAGCAGG + Intronic
1141525225 16:84606797-84606819 GTTCCTCTTAGGGTCCCTGAGGG + Intronic
1141929692 16:87193890-87193912 GTTCCTCGGAAGCTCCCAGCAGG - Intronic
1142854930 17:2724177-2724199 GTTCCTCCGCGGGGCCGAGCGGG - Intergenic
1143310077 17:5980582-5980604 CTTCCTCAGAGCCTCCCAGCAGG + Intronic
1143351508 17:6291438-6291460 GCTTCTCTGAGGGTCCGAGCTGG - Intergenic
1143598393 17:7929224-7929246 CTCTCTCGGAGGGCCCCAGCGGG + Exonic
1143637844 17:8176578-8176600 GTTCCTCAGAGGGTGCGAGGTGG + Intergenic
1144796066 17:17892119-17892141 GTGCCTCGGAGGCCTCCAGCTGG - Intronic
1144848733 17:18233449-18233471 ATTCCTAGGAGGGGCTCAGCGGG + Intronic
1147312547 17:39604115-39604137 GTGCCTCGGTGGGTGCCACCTGG - Intronic
1148124482 17:45229821-45229843 GCTCCTGGGGGAGTCCCAGCTGG + Intronic
1148502231 17:48100821-48100843 GTTCCTCTGGCAGTCCCAGCCGG + Exonic
1149724524 17:58879901-58879923 CATCCTCTTAGGGTCCCAGCTGG + Intronic
1152808785 17:82371603-82371625 GGTCGGCGGAGGGTCCCAGGCGG - Intergenic
1155392159 18:25349766-25349788 GGACCTCGGCGGGACCCAGCGGG + Intronic
1158879926 18:61768351-61768373 GTTCCTGGGAGGGACCCAGTGGG + Intergenic
1162229138 19:9251136-9251158 GATCCTCTGAGAGTCCCAGGAGG - Exonic
1164753500 19:30672869-30672891 GTTCCTCGGAGGGTCCCAGCAGG - Intronic
1164881693 19:31738345-31738367 TTACCTCGAATGGTCCCAGCTGG + Intergenic
1165460394 19:35940609-35940631 GTCCCGCGGGGGGTCACAGCTGG - Exonic
1166047759 19:40239417-40239439 GTTCCTCAGAGACTCCCACCAGG + Intronic
927653132 2:24924259-24924281 GCTCATCAGAGGGTCCCAGCAGG - Intergenic
927667215 2:25041392-25041414 GTTCCTCATAGGGTCACGGCAGG + Intergenic
929432215 2:41896914-41896936 GATCCTGGGAGGGTAGCAGCAGG - Intergenic
929441358 2:41967741-41967763 GTTTCTCCCAGGGTGCCAGCAGG - Intergenic
932350684 2:71028967-71028989 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
932354178 2:71055230-71055252 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
932955190 2:76343785-76343807 GTTTCTCAGAGGTCCCCAGCAGG + Intergenic
934590579 2:95546625-95546647 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
935679953 2:105627438-105627460 GCTCCTAGGAGGGTTCCACCTGG - Intergenic
937059248 2:118969312-118969334 CTTCATCTGAGGGGCCCAGCTGG - Intronic
940870209 2:158853645-158853667 GATCCTCTGAGAGTCCCAGGAGG - Intronic
940872921 2:158874734-158874756 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
941607784 2:167621656-167621678 GTTCATGGGAGGGACCCAGTGGG + Intergenic
947111244 2:226721620-226721642 ATTCCTCGGGTGGTCCCAGATGG + Intergenic
948460450 2:238127685-238127707 GATCCTCGGAGGGGCCGGGCTGG - Exonic
1169449049 20:5695791-5695813 GTTCCTTCGAAGGTCCCAGCAGG + Intergenic
1170593282 20:17787231-17787253 GCCCCTTGGAAGGTCCCAGCAGG - Intergenic
1170722887 20:18899983-18900005 GTTTCCCAGAGAGTCCCAGCAGG + Intergenic
1172292863 20:33788775-33788797 GCTCCCCTGAGGGGCCCAGCGGG + Intronic
1174987747 20:55474461-55474483 GCTCCCCGGTGGGTCACAGCAGG + Intergenic
1175584323 20:60126011-60126033 GTTCCTCAGCAGGTTCCAGCAGG - Intergenic
1175801003 20:61800962-61800984 GATGCTTGGAGGGTCCCAGGAGG - Intronic
1176213722 20:63938681-63938703 GTCACTCGGTGGGGCCCAGCGGG + Intergenic
1178409633 21:32352646-32352668 GTTCTTCCCAGGGTCCCAGCTGG - Intronic
1178840191 21:36132494-36132516 GTTTCTCGAAGGGTCTCTGCAGG - Intergenic
1181305829 22:21916764-21916786 GCTCCTCTGAAGCTCCCAGCAGG - Intergenic
1182779081 22:32852992-32853014 GGTCCTGGGAGGGTCCCATGGGG + Intronic
1184592989 22:45498072-45498094 GTACCTCTGCGGCTCCCAGCAGG - Intergenic
950028254 3:9835108-9835130 GTGCCTCCGAGGCCCCCAGCTGG + Exonic
954384633 3:50237644-50237666 GTGCCTCTGAGCATCCCAGCTGG + Intronic
954694080 3:52410914-52410936 GTTCCCCGGAGGTTAACAGCCGG - Exonic
954708836 3:52495149-52495171 GATGCCAGGAGGGTCCCAGCCGG + Intergenic
955743877 3:62120888-62120910 GTTCCTGGTTGGGTACCAGCAGG + Intronic
955880521 3:63539805-63539827 GTTTCTCAGAGGATCCCAGCAGG - Intronic
956951804 3:74292027-74292049 GTTTCTTGGAGGGTCACAGGAGG - Intronic
957075479 3:75599559-75599581 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
961272960 3:125703413-125703435 GATCCTCTGAGAGTCCCAGAAGG - Intergenic
961275708 3:125724575-125724597 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
961278623 3:125747170-125747192 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
961875779 3:130022463-130022485 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
962050691 3:131811658-131811680 AGTCCTCTGAGTGTCCCAGCGGG + Intronic
962955964 3:140267118-140267140 GTTCCTCCCAGGTTCCCAGGCGG + Intronic
965693869 3:171386267-171386289 CTTCCTCTGAGAGTACCAGCTGG + Intronic
966934090 3:184694490-184694512 GATTCTGGGAGGGTCTCAGCAGG - Intergenic
968703971 4:2069612-2069634 GTTCCTCCGAGGGGCCAGGCAGG - Intergenic
968988138 4:3890210-3890232 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
969019133 4:4127513-4127535 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
969023767 4:4157386-4157408 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
969329224 4:6463455-6463477 GCTGCTCAGAGGTTCCCAGCTGG - Intronic
969730050 4:8949684-8949706 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
969734916 4:8981489-8981511 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
969786217 4:9459314-9459336 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
969794134 4:9512964-9512986 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
971244354 4:24914624-24914646 GTTCTTCGGCTGGTCTCAGCTGG - Intronic
972160940 4:36226716-36226738 TTTCTTCTTAGGGTCCCAGCTGG - Intronic
976881348 4:89929131-89929153 ATTCCTGGGAGCGTCCCAGTCGG + Intronic
979602616 4:122603215-122603237 ATTCCTTGGAGGGTCCCTTCGGG - Intergenic
980869872 4:138598846-138598868 GTGCCCTGGAGGGTCCCAGCTGG + Intergenic
982833087 4:160087545-160087567 GGTCCTTGGAGGAACCCAGCGGG - Intergenic
985788321 5:1911504-1911526 GTTCCTCCCAGAGCCCCAGCTGG + Intergenic
985949952 5:3215411-3215433 GTTCCCCAGAGGGCCCCAGGAGG + Intergenic
992994899 5:82323183-82323205 GTTCCCTGGAGCTTCCCAGCAGG + Intronic
995736228 5:115302849-115302871 ATTCCTCAGAGGTCCCCAGCTGG - Intergenic
1000233636 5:159337707-159337729 GTTCCTGGGTGGGGCCCATCCGG - Intergenic
1002462316 5:179380546-179380568 GTTCCTCGAAGGTTTCCTGCTGG - Intergenic
1002674620 5:180900801-180900823 GTTCCTCCAAAGGTCCCAGTGGG - Intronic
1004551922 6:16656177-16656199 GGTCCTCGGGGGGTCCCTCCTGG - Intronic
1006426672 6:33967657-33967679 GTGCCTCAGAGGGTCCCAGTGGG + Intergenic
1007920371 6:45603935-45603957 GTTCATGGGAGGGACCCAGTGGG - Intronic
1012825132 6:104138460-104138482 GTTCATGGGAGGGACCCAGTGGG - Intergenic
1019515944 7:1440230-1440252 GTTTGCAGGAGGGTCCCAGCAGG - Intronic
1020310871 7:6867562-6867584 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1021560205 7:21961952-21961974 CATCCTCTCAGGGTCCCAGCTGG - Intergenic
1026291142 7:69007320-69007342 TGTCCTGGGAGGGACCCAGCAGG - Intergenic
1029077576 7:97947872-97947894 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1034798684 7:154037215-154037237 GTGCCTCGCAGGGTCAAAGCTGG - Intronic
1036261845 8:7247526-7247548 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1036304748 8:7592026-7592048 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1036313885 8:7706071-7706093 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1036355597 8:8040018-8040040 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1036390486 8:8320271-8320293 GTTCCTCTGAGGGTTCCTTCTGG - Intronic
1036435490 8:8729361-8729383 GTACCTTGGAGGTTCCCTGCTGG - Intergenic
1036832744 8:12034525-12034547 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1036902919 8:12685048-12685070 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1038241139 8:25808888-25808910 GTTCCTTTGAGGGTCCCACCTGG + Intergenic
1039193801 8:35007300-35007322 GTTCCTCAGAGAATCACAGCTGG + Intergenic
1039419660 8:37425551-37425573 GATCCACAGAGAGTCCCAGCAGG + Intergenic
1047521477 8:125598543-125598565 ATTTCTCGGAGGGTCCCAGCAGG + Intergenic
1047782316 8:128120076-128120098 GTGCCTGGTAGGGTCCCAGTAGG + Intergenic
1049813606 8:144587614-144587636 CTTCCTCGTGGGGACCCAGCAGG - Intronic
1056598260 9:88025558-88025580 ATTCCTCTGAGGCCCCCAGCAGG + Intergenic
1056796936 9:89665055-89665077 GTTCCTAGTAGTGTCCCAGAGGG - Intergenic
1056866552 9:90232193-90232215 GATCCTCTGAGAGTCCCAGGAGG - Intergenic
1056916607 9:90752123-90752145 GATCCTCTGAGAGTCCCAGGAGG + Intergenic
1056929466 9:90862138-90862160 CTTCCTCCCAGGGTCCCACCTGG + Intronic
1057005665 9:91556367-91556389 GTTGCTCAAAGGGTCCCAGTGGG + Intergenic
1057169655 9:92953960-92953982 GTTCATTGGAGATTCCCAGCCGG - Intronic
1058975761 9:110124205-110124227 GTGCTTGGGAGGGTCCCAGGAGG + Intronic
1060269652 9:122131706-122131728 GCTCCTCGGAGAGGCCCAGTCGG + Intergenic
1061385105 9:130285094-130285116 GTCCCTGGGTGGGTCCCATCTGG + Intronic
1061828923 9:133278229-133278251 GCTCCTCTTAGGGTTCCAGCTGG - Intergenic
1062010269 9:134263377-134263399 TTTCCTCCGAGGGTCCCCTCTGG + Intergenic
1062049233 9:134438574-134438596 GTGCCTGGGAGGGGCCCAGCTGG - Intronic
1186611819 X:11145343-11145365 CTTCCTCTGAGGTTTCCAGCAGG + Intronic
1186756808 X:12679767-12679789 GTTTCCCAGAGGTTCCCAGCAGG + Intronic
1188960961 X:36490960-36490982 ATTCCTGGGAGGGACCCAGTGGG - Intergenic
1200346355 X:155452863-155452885 TTTCCTGGGAGGGACCCAGTGGG + Intergenic