ID: 1164753976

View in Genome Browser
Species Human (GRCh38)
Location 19:30676339-30676361
Sequence CTGTGAATGTGTAAAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164753970_1164753976 25 Left 1164753970 19:30676291-30676313 CCTTTGTGCATAAAACCTGAACT 0: 1
1: 1
2: 1
3: 9
4: 135
Right 1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG 0: 1
1: 0
2: 0
3: 32
4: 347
1164753973_1164753976 -1 Left 1164753973 19:30676317-30676339 CCCATTGAGAGTCTATGGCCATC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG 0: 1
1: 0
2: 0
3: 32
4: 347
1164753971_1164753976 10 Left 1164753971 19:30676306-30676328 CCTGAACTGTGCCCATTGAGAGT 0: 1
1: 0
2: 0
3: 15
4: 114
Right 1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG 0: 1
1: 0
2: 0
3: 32
4: 347
1164753974_1164753976 -2 Left 1164753974 19:30676318-30676340 CCATTGAGAGTCTATGGCCATCT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG 0: 1
1: 0
2: 0
3: 32
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164753976 Original CRISPR CTGTGAATGTGTAAAGAAGA TGG Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
903597825 1:24509507-24509529 CTGTGAATGAGCAAAGAGGGTGG - Intronic
903696262 1:25209605-25209627 CTGTGAATATGTAAAAATCACGG - Intergenic
906138383 1:43517081-43517103 CTGTGAATGGATAAACAAAATGG - Intergenic
906302284 1:44691594-44691616 CTGAGAGTGAGTAGAGAAGAGGG - Intronic
906986738 1:50691016-50691038 ATGTGAATGTTTATAGGAGATGG - Intronic
907316286 1:53574788-53574810 CTGTGAATGTGGTAAAAAGCTGG + Intronic
909311398 1:74154364-74154386 CTGTAAAATTGTAAAGAACAGGG - Intronic
909728195 1:78861558-78861580 CTGTGAATGTGTCAGGGAGGCGG - Intergenic
909910824 1:81255833-81255855 CTGGGAAAGTGCAAAGAAGGAGG - Intergenic
910436415 1:87210455-87210477 CTGTGCATGTGAAATGAAGAGGG - Intergenic
910615334 1:89191507-89191529 CTGTGGAATTGTAAAAAAGAGGG + Intronic
911273723 1:95835215-95835237 TTGTAAAGGTGTAAAGAAAAGGG - Intergenic
916239448 1:162624362-162624384 CTGGGAATGCGGAAAGAAGCTGG - Intergenic
916748913 1:167706451-167706473 TTGTGAATGTGTGATGAAAAGGG + Intergenic
919034175 1:192284511-192284533 CAGGTAATTTGTAAAGAAGAGGG - Intergenic
920630144 1:207644760-207644782 TTGAGACTGTGAAAAGAAGACGG + Intergenic
920703017 1:208232031-208232053 CTGTGAATGTTTAGAGGAAAAGG + Intronic
921878813 1:220230261-220230283 CTCTGAATGTGAAACAAAGAAGG + Intronic
923449314 1:234101744-234101766 CTAAGAATGTGTCAAGAAAAAGG - Intronic
1063956105 10:11268851-11268873 ATGTGAATGTTGAAAGAACAAGG + Intronic
1066321631 10:34308660-34308682 AAGTGAATGTGTCAAGAAGATGG + Intronic
1069083092 10:64109177-64109199 CTGTGACTCTGAAAAGAAGAAGG + Intergenic
1071213856 10:83375982-83376004 CATAGAATGTGTTAAGAAGAAGG - Intergenic
1073578650 10:104644381-104644403 GTGAGCCTGTGTAAAGAAGATGG + Intronic
1073776096 10:106787994-106788016 CTTTGAATGTGTCATGAATAGGG + Intronic
1074053428 10:109900391-109900413 CTGTGATTGTGAGAACAAGAAGG - Intronic
1074585703 10:114766476-114766498 CTGAGGATGTGAAATGAAGATGG - Intergenic
1074724061 10:116289519-116289541 CTGTGAAGGTATAAAGCAGTGGG + Intergenic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075574742 10:123570283-123570305 CTGAGAATGTGTTAGAAAGATGG + Intergenic
1076040428 10:127243160-127243182 CTGTGAAGGTGTAATAAAAATGG - Intronic
1076269880 10:129142879-129142901 CTGTGTTTGTGTGCAGAAGATGG + Intergenic
1076393278 10:130119854-130119876 CTGGGAATGTTTAAATAAGAGGG - Intergenic
1077875505 11:6301656-6301678 TTGTGGATGTGTAATGAACAGGG + Intergenic
1078025405 11:7690276-7690298 ATGAGAATGTGTAAGGAAGCTGG + Intronic
1078460556 11:11512061-11512083 CTGTGAATGTGTAAAAATTATGG - Intronic
1084638449 11:70409363-70409385 CTTTGAATGTATAAAAAAGCTGG + Intronic
1085700113 11:78738355-78738377 CTGATAATGTGGAAAGAGGATGG - Intronic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086417867 11:86607149-86607171 CTGTGAATGTGTTAAGTTGATGG - Intronic
1086935005 11:92735488-92735510 CTGTAAATGTGTTAAGCTGATGG + Intronic
1089697009 11:120222084-120222106 CTGTGAAGGTTGGAAGAAGAGGG + Intronic
1089704744 11:120269849-120269871 ATGTGGATGTGTAAAGAGAAGGG + Intronic
1090357973 11:126153319-126153341 ATGTGAATGGCTAAATAAGAAGG - Intergenic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1095261016 12:40099759-40099781 CTGTTAATGTGTATAAAACAAGG + Intronic
1095299984 12:40573093-40573115 AAGTGAATGCTTAAAGAAGAAGG - Intergenic
1095799881 12:46260798-46260820 CTGTGAAACTGTAAGGAATAAGG - Intronic
1096327395 12:50676889-50676911 CTGGGAATGTACAAAGCAGAAGG + Intronic
1097146129 12:56940552-56940574 CCCAGAATGTGTAAAGTAGAGGG + Intergenic
1097151846 12:56985029-56985051 CCCAGAATGTGTAAAGTAGAGGG + Intergenic
1099759407 12:86897526-86897548 CTTTGAAAGGGTAAACAAGATGG + Intergenic
1099896977 12:88660611-88660633 AAGTGAATGGGTAAAGAAAATGG + Intergenic
1100100270 12:91095116-91095138 ATATGAATGTGTTAAGAAGTGGG + Intergenic
1102310418 12:111840647-111840669 CGGTAAAGGTGTAGAGAAGATGG - Intergenic
1105352015 13:19624329-19624351 CTGTGAATATGTCAAGCACAGGG - Intergenic
1105657778 13:22459120-22459142 TTGTGGATGTGTAAAGCAGTAGG - Intergenic
1105753691 13:23445394-23445416 CTGTAAATGTTAAAAGAAGAGGG + Intergenic
1106863148 13:33933653-33933675 CTGTGAAATTGAAAATAAGAAGG + Intronic
1107412457 13:40170661-40170683 CTGTAAATTTGTAAAGTTGAAGG + Intergenic
1108962833 13:56257787-56257809 TTGTGGGTGAGTAAAGAAGATGG + Intergenic
1109704349 13:66070495-66070517 CTGCTAATGTGAAAAAAAGAAGG - Intergenic
1109992566 13:70078243-70078265 CTGTGAATGTTGTAATAAGAAGG - Intronic
1110579748 13:77108151-77108173 ATCTGAATGTGGAAAGAAGATGG + Intronic
1110732917 13:78901381-78901403 TTGTGTATGTGTAAGGAAGGGGG - Intergenic
1112034456 13:95484534-95484556 ATGTAAGTGTGTAAAGAAGCAGG + Intronic
1112806436 13:103168152-103168174 ATGTGAATATGAATAGAAGAGGG - Intergenic
1112983750 13:105420484-105420506 ATGTCAATGTGTAAGGATGATGG - Intergenic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114477203 14:23004577-23004599 ATGGGAATGTCTAAAGAATATGG + Intronic
1115019867 14:28663865-28663887 CTGTGATTGTGTAAAAGACAGGG + Intergenic
1115197009 14:30812307-30812329 CTGCGCATGTGTAAAAAAGGTGG + Intergenic
1115393447 14:32879415-32879437 ATGTGAATGTGCAGAGAGGAGGG - Intergenic
1115892241 14:38044311-38044333 CTGTGAAGGTGAAAGGAAAATGG + Intergenic
1117096220 14:52301025-52301047 GTTTGAAAGTGCAAAGAAGATGG - Intergenic
1117784380 14:59267355-59267377 ATGTGAATCTTTAAAGAAGGTGG + Intronic
1117845142 14:59903856-59903878 CTGTAAATCTGTAGAGAAAAGGG + Intergenic
1119401846 14:74368054-74368076 CAGTGAATGAGCAGAGAAGATGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120179193 14:81325852-81325874 CTGAGAAGGGATAAAGAAGAGGG + Intronic
1121611925 14:95287119-95287141 CTGTGAATTTGCACAGAGGAGGG + Intronic
1121883036 14:97517312-97517334 TTCTTAATTTGTAAAGAAGAGGG - Intergenic
1122832206 14:104403984-104404006 CTGCGAATGAGAAAGGAAGAAGG + Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1124247393 15:28082609-28082631 CTATGGATGTGTAAAGAATAAGG + Intronic
1125350372 15:38760441-38760463 CTATGAAAGTGTAGAGAAGATGG + Intergenic
1127650936 15:61006413-61006435 CTCAGAAGGTGTCAAGAAGAGGG + Intronic
1128436835 15:67660493-67660515 CTCTGAAAGTGTACTGAAGATGG + Intronic
1128614959 15:69101779-69101801 TTGAGAAAGTGAAAAGAAGAGGG - Intergenic
1131962919 15:97808161-97808183 CTGTATTTGTGTAAAGACGATGG - Intergenic
1132174703 15:99702056-99702078 CTGTGTATGTGTAAAACATATGG - Intronic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132582608 16:692188-692210 CTGTTACTGTGTATAGAACAGGG + Intronic
1133478965 16:6151003-6151025 TTCTGAATCTGTAAGGAAGAAGG - Intronic
1135417857 16:22282506-22282528 CTGTGAAGGTGTCAAGAGGTGGG + Intronic
1135616840 16:23918103-23918125 TTGTGAATCTCTAAACAAGAGGG + Intronic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1136082961 16:27864904-27864926 CTGTGAATGTTTTCAGATGAAGG - Intronic
1136121319 16:28137087-28137109 CTGGGAATGTGGAATGAAGCTGG - Intronic
1136232093 16:28892504-28892526 GGCTGACTGTGTAAAGAAGACGG + Intronic
1137010095 16:35312921-35312943 CTGTGCATGTGCAAAAAAGTTGG - Intergenic
1138158890 16:54734699-54734721 CTGTGGAGGTGAATAGAAGAGGG - Intergenic
1141240494 16:82260925-82260947 CTGTTAATGTGAAAATAAAAAGG - Intergenic
1141335474 16:83150954-83150976 CTGGGAATGTAAAAAAAAGATGG - Intronic
1142470805 17:162282-162304 CTGTGAATGTGTTATCAACATGG + Intronic
1142517231 17:440513-440535 TTGTGAATGTGTAATGTAAATGG - Exonic
1142519293 17:493772-493794 CTGTAAATCTGTAAAGGAGGAGG - Intergenic
1142913488 17:3114534-3114556 ATGTGAAAGTTTAAAGATGATGG - Intergenic
1144080639 17:11760925-11760947 CTGTGACTGTATAAAATAGAAGG - Intronic
1144505938 17:15830939-15830961 CTGTGAATCTGTGAATAAGGAGG - Intergenic
1144553437 17:16261168-16261190 CTGGGAATGTGGCAAGCAGAGGG - Intronic
1145170115 17:20648870-20648892 CTGTGAATCTGTGAATAAGGAGG - Intergenic
1145828390 17:27894532-27894554 TTATGCATGTGTAAATAAGAGGG - Intronic
1145949947 17:28809022-28809044 CTTGGAATGTGTTAAGAAAAAGG - Intronic
1147941219 17:44049710-44049732 CTGGGCATGTGGAAATAAGATGG - Intronic
1149309964 17:55384090-55384112 CAGTGAACATTTAAAGAAGAGGG - Intergenic
1149659952 17:58329000-58329022 GTGAGAATGTGTGAAGATGAGGG - Intergenic
1149732744 17:58962701-58962723 CTGTGGAGGTATATAGAAGAAGG - Intronic
1152177315 17:78796382-78796404 CTCTGAATGTTCAAAGATGAGGG - Exonic
1152999888 18:445025-445047 CTGTGAATATCCTAAGAAGAGGG - Intronic
1153697735 18:7661485-7661507 CAATGAATGTGCCAAGAAGAGGG + Intronic
1153993204 18:10418123-10418145 CTGTAACTGTGTAAAAAAAAAGG - Intergenic
1156633142 18:38994762-38994784 CAGTGAATGTGAATAAAAGAGGG + Intergenic
1156912325 18:42425743-42425765 CTCTGACTGTGGAAAGAGGAGGG - Intergenic
1157868893 18:51211352-51211374 CTCTAAATGGGTAAAAAAGAGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158098294 18:53800468-53800490 CTGTGAATCTGTACAGAGAATGG - Intergenic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158806565 18:60980536-60980558 CTGTGAAAGTGTTCAGATGATGG - Intergenic
1158827040 18:61233854-61233876 CTGAGTATATGTAAAGAAAAAGG + Intergenic
1158895430 18:61908601-61908623 ATGTGAAAATGTAAAGAAGTAGG - Intergenic
1159775282 18:72597777-72597799 CTTTGCTTGTGTAAAGGAGAAGG - Intronic
1159947449 18:74454904-74454926 CTGAGAATGTGTAAAGAGTAAGG + Intronic
1162747341 19:12806190-12806212 CTTAGAATGTGTACAGAAGCAGG + Intronic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163877212 19:19882354-19882376 CTGTGAATTTTTAGTGAAGAGGG + Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
1167764277 19:51469796-51469818 CTGGGACAGTGAAAAGAAGAAGG + Intergenic
926081341 2:9988876-9988898 CTGTGTATCTATAAAGAATAAGG - Intronic
926336016 2:11863525-11863547 CTGTGAATGAGTTCAGAACAAGG + Intergenic
926672288 2:15587699-15587721 CTGGGAAAGTGTAGAGAGGATGG - Intergenic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928587944 2:32780963-32780985 CTTTGAATGTCTGAAGAACAAGG + Intronic
929270527 2:39966531-39966553 TTGTCAATGGGTAAAGATGATGG + Intergenic
929411798 2:41705061-41705083 TTGTGAAGGTCTTAAGAAGAGGG + Intergenic
931833609 2:66076878-66076900 CTGTGAAGTTATAAAGAGGAAGG - Intergenic
933556647 2:83838469-83838491 CTGTAAATGTGTTAGAAAGAAGG - Intergenic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
933665804 2:84963918-84963940 TGGTGAATGTTTATAGAAGAGGG + Intergenic
936470281 2:112792469-112792491 CTGGTAATGTATAAAGAAAACGG - Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938602412 2:132855708-132855730 AGGTGAGTGAGTAAAGAAGAAGG - Intronic
938619323 2:133032370-133032392 CTATGGATTTGGAAAGAAGAGGG + Intronic
939172982 2:138717116-138717138 CTATGAAGCTGTAAAAAAGAAGG + Intronic
939325694 2:140685139-140685161 CTGTGAATGAAGAAAGTAGAGGG - Intronic
939430803 2:142104534-142104556 CTGTGAGTGTTTATATAAGATGG + Intronic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
940627603 2:156194856-156194878 ATGTGAATGTGTAAAATGGAAGG + Intergenic
941134765 2:161700423-161700445 CATTGGATGTGGAAAGAAGAAGG + Intronic
942726851 2:179019023-179019045 CTGTGGGTGTCCAAAGAAGAGGG - Intronic
943065350 2:183080445-183080467 CTGTAAATGTGACAAGAATATGG - Intronic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
944995677 2:205290870-205290892 TTGAGAATGTGGCAAGAAGATGG + Intronic
946882638 2:224191860-224191882 ATGTAAAGGTGAAAAGAAGATGG + Intergenic
946919295 2:224561420-224561442 GTATGAATGTGAAAAGAGGAAGG + Intronic
946962392 2:224998719-224998741 GAGTGAATGGGAAAAGAAGAAGG - Intronic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
948439296 2:237976346-237976368 CAATGATTGGGTAAAGAAGATGG - Intronic
948515703 2:238502752-238502774 CTGTGTATCTGTAAAGAATTCGG + Intergenic
1168949433 20:1786506-1786528 CTGTGAATATTCAAAGAAGAAGG - Intergenic
1169277157 20:4241542-4241564 CAGTAAATGTGTGCAGAAGAAGG - Intronic
1169296769 20:4406716-4406738 AAGAGAATGTGGAAAGAAGAGGG + Intergenic
1169360192 20:4941889-4941911 CTGTGTATGTGTAAAGTATGTGG + Intronic
1169649668 20:7853077-7853099 GTTTGCATGTGGAAAGAAGAGGG - Intergenic
1169789746 20:9397216-9397238 TTGTGAATGAGCAAAGAAGGTGG - Intronic
1173356038 20:42291549-42291571 CTGTGCATGTGTAAGGGAGATGG + Intronic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1177241804 21:18467695-18467717 GTGTGTCTGTGTAAAGAGGAAGG + Intronic
1178211032 21:30532188-30532210 CTGCAAAGGTGTAAAGAAAAGGG - Intergenic
1178993940 21:37379653-37379675 CTGTGAATCTGTAAAGGAAAAGG + Intronic
1179155279 21:38844953-38844975 CTGGGACTGGGTAAAGAAAAGGG - Intergenic
1179505674 21:41838670-41838692 CTGTGAATAGGCAGAGAAGATGG - Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1182608577 22:31527352-31527374 CTGTGTGTGTGTAAAGAAAAAGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949426024 3:3916986-3917008 CTATTCATGTGTACAGAAGATGG - Intronic
950255062 3:11497777-11497799 CAGTGAATGTATACAGCAGATGG - Intronic
952059544 3:29491106-29491128 CTGTGAAGGTTTGAAGAAAAAGG + Intronic
952665047 3:35894351-35894373 CTGTCCTTGTGTAAACAAGAGGG - Intergenic
956645073 3:71447287-71447309 TTGAGAATGTGTAAGGCAGAGGG - Intronic
956814789 3:72898417-72898439 ATGTTAATTTGGAAAGAAGAAGG + Intronic
957003175 3:74910490-74910512 CTGTAAATTTTTAAAAAAGAAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
960155651 3:114295104-114295126 CAGTGAATGTGAAAGGAAAAGGG + Intronic
960349883 3:116578955-116578977 CTGGCAATGTTTAAAGAAGAAGG - Intronic
960397490 3:117154802-117154824 CTTTGAATGTTTAAAGAAGGAGG - Intergenic
960564974 3:119123256-119123278 CTTTGCCTGTGTAAAGAGGAGGG + Intronic
961674077 3:128554563-128554585 AGGTGAATGTCAAAAGAAGAGGG + Intergenic
961781255 3:129321701-129321723 GTGTGAATGTGTAAGAAAGTGGG - Intergenic
961855182 3:129863485-129863507 CTGAGAAGGTGAAAAGAAAAAGG + Intronic
962112070 3:132462041-132462063 TTGGGAATTTGTAAAGAAAAGGG - Intronic
962284798 3:134076660-134076682 CTGTGTGTGTGTAAATAGGAGGG + Intronic
962674368 3:137743539-137743561 CTGGGATTCTGTTAAGAAGAAGG + Intergenic
964140097 3:153388129-153388151 CTGTGATTCTGTAAGCAAGAAGG + Intergenic
964309307 3:155375700-155375722 GTTAGAATGTGTAATGAAGATGG - Intronic
965806668 3:172549364-172549386 GTGTGTGTGTGTAAAGAAAAAGG + Intergenic
965832302 3:172806228-172806250 CAGTGAAAGTGTTAAGATGAGGG - Intronic
966548219 3:181175167-181175189 CTGTGAATGGAAAAAGGAGAAGG + Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
967087263 3:186107413-186107435 TTGTGAATGTGTTAGGAGGAAGG + Intronic
967636028 3:191804325-191804347 CTCTGTATGGGGAAAGAAGAGGG + Intergenic
969702500 4:8775393-8775415 CTATGAATTTGGAAAGGAGAGGG - Intergenic
969980891 4:11153072-11153094 CTGTGAAGATGTAAACAATATGG + Intergenic
970609889 4:17715088-17715110 ATGTGTATGTGTATAAAAGACGG - Intronic
970970400 4:21976538-21976560 CTGAGAATATGTAAAGAAAAGGG - Intergenic
971895165 4:32583124-32583146 CTGTGTATGTGTGAATAATATGG + Intergenic
972770619 4:42193870-42193892 TTGGGAATGGGTAAAGCAGAGGG + Intergenic
975099693 4:70498523-70498545 CTGTGAATATGTCAATAAAAAGG - Intergenic
975350868 4:73344526-73344548 CTGGGAATATATAAAGAAAATGG - Intergenic
976264101 4:83173873-83173895 CTTTCAATGTATAAAGAGGAAGG - Intergenic
976393251 4:84527647-84527669 GTGTGCATGTCTAAAAAAGAAGG + Intergenic
976969373 4:91085995-91086017 GTAAGAATGTTTAAAGAAGAGGG + Intronic
976985131 4:91285026-91285048 CTGCTAATGTGAACAGAAGATGG + Intronic
977033039 4:91911748-91911770 CTGTGTATGTGTAAAGATACAGG - Intergenic
977362813 4:96028427-96028449 CTGTGAATGGGAAAAGAATGGGG + Intergenic
978035645 4:103990114-103990136 CTGTGAATGTGCAGAGAAAAGGG - Intergenic
978822424 4:112980529-112980551 CTGTGAATGGCAAATGAAGAAGG + Intronic
978878849 4:113675825-113675847 CTGTGAATGAATAAAGCATAGGG - Intronic
979002320 4:115238828-115238850 CTGAGAATGTGTCAAAAAGGAGG - Intergenic
979306430 4:119149653-119149675 CTCTGAAAGTGTAAAGAAATAGG - Intronic
979517996 4:121633456-121633478 CTGTAAATGTGCAGAGAAAAGGG + Intergenic
979665423 4:123305552-123305574 CTGTGAAACTGAAAAGAACATGG + Intronic
979929535 4:126613827-126613849 CTGTGAATTTGGGAAGAATAAGG - Intergenic
979930998 4:126630401-126630423 CTGTGAATCTGTGCCGAAGAGGG + Intergenic
980554213 4:134381762-134381784 CTATGTATGTGTTAAGAAGTTGG - Intergenic
980768328 4:137337401-137337423 CAGTGAAAATGTAAAGGAGAAGG - Intergenic
981119481 4:141033275-141033297 TTTTGAATGTGTAAAGAAAGTGG - Intronic
981321114 4:143392843-143392865 CTATCCATCTGTAAAGAAGATGG + Intronic
981936692 4:150247047-150247069 CTGTTAAAGTGCAAAGAAGAAGG + Intronic
982990211 4:162263971-162263993 CTGTGAATGTGTTAAGTACATGG - Intergenic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985974948 5:3410931-3410953 GTGTGAATGTATAAAGAAAGAGG - Intergenic
986615769 5:9615879-9615901 GTGTAAATGTGTAAGAAAGATGG - Intergenic
987237339 5:15956177-15956199 CTGTGAAAGTGTAAGGACTAAGG + Intergenic
987365511 5:17145089-17145111 CTGTGATTTTGTAATAAAGAGGG - Intronic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
989533944 5:42541825-42541847 CTGAGAATCTGGAAAGATGAAGG + Intronic
990098321 5:52148734-52148756 CTTTGAATGTTTTAAGAAAAAGG - Intergenic
990998217 5:61754994-61755016 CTGTGAATCTGACAACAAGATGG - Intergenic
991939304 5:71835069-71835091 ATCTGAATATGTAAAGAAGTTGG + Intergenic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993167035 5:84370017-84370039 CTGTTTATGTGTTAAGAAAAAGG - Intronic
993360881 5:86974885-86974907 CTGTGAATTTGTAGTGAATAAGG - Intergenic
993772904 5:91953236-91953258 CTGAGAATTTGCAAAGAAAAAGG + Intergenic
994665697 5:102702476-102702498 CTGTAAATGTTTAAAGAAATAGG - Intergenic
994729931 5:103480278-103480300 CAGTGAAAGGGTAAATAAGAAGG - Intergenic
996636375 5:125694034-125694056 CTGTGAAGGAGGAAAGAATATGG - Intergenic
997511561 5:134458249-134458271 CTGTGAATGTGTAATTGGGAAGG - Intergenic
998488269 5:142523014-142523036 CTGTGAATGGGGAAAGAAAGGGG - Intergenic
1000301526 5:159960947-159960969 CTGTGAATGACTAGAAAAGAGGG - Intronic
1000470718 5:161637803-161637825 CTGTGAACTTGAAAAGAAAATGG + Intronic
1001877452 5:175213656-175213678 GTGGGAATGTGAAAAGAAAAAGG - Intergenic
1002807638 6:592390-592412 CTGGGAATGTTTAATGATGAAGG - Intronic
1003314259 6:4997501-4997523 CTGAGAATCAGGAAAGAAGATGG - Intronic
1003370517 6:5521415-5521437 CTGTGAATGTATAAAGGGAAAGG + Intronic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1006705035 6:36012564-36012586 GTGGGAATGTGTAGAGACGAGGG - Intronic
1007106620 6:39287722-39287744 CAGAGAATGAGAAAAGAAGATGG + Intergenic
1007832434 6:44648740-44648762 ATGTGCATGTGTAAAGGAGCAGG - Intergenic
1008082082 6:47205120-47205142 ATGTGCATTGGTAAAGAAGAAGG - Intergenic
1009507297 6:64500812-64500834 ATGTGATTGTGTCAAGATGATGG + Intronic
1009880358 6:69559674-69559696 GGGTGTATGGGTAAAGAAGAAGG - Intergenic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1010581631 6:77606038-77606060 CTGATAATATGTAAAGAAAAAGG + Intergenic
1011813976 6:91166681-91166703 CTGTGAATTTAAAAAGAAAAAGG - Intergenic
1012321772 6:97856830-97856852 GTTTGCATGGGTAAAGAAGAAGG - Intergenic
1013545210 6:111150087-111150109 CAGTGCATGTGTTAAGAAGTGGG + Intronic
1014012916 6:116497259-116497281 GTGTGAATCTGCAAAGAGGAGGG + Intronic
1015054263 6:128881115-128881137 CTGGGAAAATGTAAAGAGGAAGG + Intergenic
1016245877 6:141980389-141980411 GTTTGAATGTGTAAACAAGTTGG - Intergenic
1016486880 6:144550291-144550313 GGGTGAATTTGTAAAGAGGAAGG + Intronic
1016827027 6:148397938-148397960 CTGTGCAGGAGTACAGAAGAGGG + Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1018140285 6:160826658-160826680 TGGTGAATGTGTAAACAAAATGG + Intergenic
1018624291 6:165762843-165762865 CCTTGAATGTGTGAAGCAGAAGG - Intronic
1019957976 7:4432146-4432168 CTATGAAATTGTGAAGAAGAGGG + Intergenic
1020047970 7:5057661-5057683 CTGTTAATGGGAAAAGAAGGAGG - Intronic
1020073623 7:5243360-5243382 CTGCGAGTCTGTCAAGAAGAGGG - Intergenic
1020987228 7:15151246-15151268 CTTTGAATGAATAAATAAGATGG - Intergenic
1021285144 7:18771512-18771534 CTGTAAATTTATAAATAAGAGGG - Intronic
1021364027 7:19753700-19753722 CTGTTCATTTCTAAAGAAGAAGG + Intronic
1022275877 7:28854705-28854727 CTGTGGATAGGTAAAGAATAGGG - Intergenic
1022331484 7:29383481-29383503 CAATGACTGAGTAAAGAAGATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023658421 7:42449155-42449177 CAATGAATGAGTAAGGAAGACGG - Intergenic
1025972657 7:66342543-66342565 CTGGTAATTTATAAAGAAGAGGG + Intronic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1026728472 7:72890992-72891014 TTGTTAATGGGAAAAGAAGAAGG - Exonic
1027115361 7:75474800-75474822 TTGTTAATGGGAAAAGAAGAAGG + Exonic
1027120544 7:75515829-75515851 CTGTTAATGGGAAAAGAAGAAGG + Intergenic
1027286489 7:76650494-76650516 TTGTTAATGGGAAAAGAAGAAGG + Intergenic
1027661664 7:80995392-80995414 GTGTTAATGTGGAAAGAAGGAGG - Intergenic
1029722243 7:102376189-102376211 CTGTTAATGGGAAAAGAAGAAGG - Intronic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1031384687 7:121134192-121134214 CAGTGAATGGATAAAGAAAATGG + Intronic
1032491966 7:132330544-132330566 ATGTGAAAATGTAAAGAAGTTGG + Intronic
1032584413 7:133132945-133132967 CTGTAAATAAGCAAAGAAGAAGG + Intergenic
1033916675 7:146334710-146334732 CTCTGCAAGTGTAATGAAGAGGG + Intronic
1034024983 7:147691771-147691793 CTGAGTATGTGTGAAGATGAGGG - Intronic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036622534 8:10434252-10434274 CTGTGAAAGAGTAAAAATGAGGG + Intergenic
1037193271 8:16153638-16153660 CTGTGAATGTATGAAATAGAAGG - Intronic
1037263535 8:17034781-17034803 CTATGAATGAGCAAAGAAAATGG + Intronic
1039314317 8:36354898-36354920 CTGTTAACGTGAACAGAAGATGG - Intergenic
1039355078 8:36806136-36806158 CTGTGTATATGTAAAATAGAAGG + Intronic
1040853127 8:51922730-51922752 CTGTTAATGTGAAAAGAAGTAGG + Intergenic
1040885637 8:52260695-52260717 GTGTGTATGTGTATAGAAGAAGG - Intronic
1043161560 8:76853283-76853305 CTGAGAATGTCTTAAGAAGTTGG - Exonic
1043944670 8:86236082-86236104 TTGTGAATGAGCAAAGAAAATGG - Intronic
1045130431 8:99145935-99145957 CTGGGAAGATGTAAAGAAGCTGG - Intronic
1045576853 8:103431825-103431847 CTGAGAATGTGCAAAGCAGGAGG - Intronic
1045733377 8:105267227-105267249 CTTTGCCTGTGGAAAGAAGAGGG - Intronic
1046139179 8:110067680-110067702 CTTTGAATGTTTTAAGGAGATGG - Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1046994550 8:120502868-120502890 CTGTGTATGTCTATGGAAGATGG - Intronic
1047020086 8:120766106-120766128 CTGTGAAAATGACAAGAAGAGGG + Intronic
1048664385 8:136644330-136644352 CTGTGAGGGTATTAAGAAGAGGG - Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1051356301 9:16242369-16242391 CTTTAAATGTGTAAATAGGATGG + Intronic
1051668125 9:19484408-19484430 CTGTGAATGGTTCAAGAGGAAGG - Intergenic
1051784051 9:20722306-20722328 TTGTGGATGTCTAGAGAAGAGGG - Intronic
1052099724 9:24430739-24430761 CTGTAAATGTGTAAAAGAGGTGG - Intergenic
1052140970 9:24982846-24982868 TTGTGCATTTTTAAAGAAGACGG + Intergenic
1052715927 9:32117074-32117096 ATGTGCATGTGGAGAGAAGATGG - Intergenic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1056011997 9:82342243-82342265 CTGTGTATGTGTTAAAAAGCAGG + Intergenic
1057021580 9:91702009-91702031 TTGTGAGGGTGTAGAGAAGAGGG - Intronic
1058473464 9:105305285-105305307 CTAAGAATGAGGAAAGAAGAAGG - Intronic
1059266239 9:113034089-113034111 CTGAGAATGAATAATGAAGAAGG + Intergenic
1059822913 9:117993944-117993966 ATGTGAATGTTAAAAGAAGCTGG - Intergenic
1060616420 9:125019017-125019039 GTGTGTATATGTCAAGAAGAAGG - Intronic
1061255279 9:129451595-129451617 CTGTGAATGTGAAGACAGGAAGG + Intergenic
1061328261 9:129877054-129877076 GTGTGACTGTGTTTAGAAGAGGG + Intronic
1185550468 X:979902-979924 CTGGAAACGTTTAAAGAAGAGGG + Intergenic
1186686320 X:11928618-11928640 TTGTGAGTCTGTAAAGAAAAAGG + Intergenic
1186834837 X:13427463-13427485 CTGTGAAGATGTAAACAACATGG - Intergenic
1187245271 X:17548208-17548230 CTGTGAAGGTGTCAAGGACATGG + Intronic
1187543340 X:20221789-20221811 ATGTGAATGTGTACAAAGGATGG - Intronic
1187693205 X:21892810-21892832 AAGAGAATGTGTCAAGAAGAGGG + Intergenic
1187777450 X:22778105-22778127 CTGTGAATATGTGAAGAAATTGG - Intergenic
1187791011 X:22950350-22950372 CTGTGATTGTGTGAAGAATAAGG - Intergenic
1187971277 X:24661344-24661366 CTTAGAATGAGTAATGAAGAAGG + Intronic
1193236667 X:79114824-79114846 CTGAGACTGTGTAAAGAAGCAGG + Intergenic
1193246110 X:79232155-79232177 TTCTGCCTGTGTAAAGAAGAGGG - Intergenic
1195687010 X:107596695-107596717 GTCTGAATGTGTAAAGTATATGG - Intronic
1195773816 X:108381042-108381064 CTGGGAATTTTTATAGAAGATGG - Intronic
1197687525 X:129457379-129457401 GTGTGACTGTGTAAAGAAACTGG + Intronic
1199811335 X:151352812-151352834 CTGTGAATGGGGAAAGCAGAAGG + Intergenic
1200311530 X:155083522-155083544 ATGTAGATGTGTAAAAAAGAGGG - Intronic
1200366462 X:155670957-155670979 CTGTGGATGTGGAAAGATTATGG - Intergenic
1201305143 Y:12543255-12543277 CTGTCCATGTGTTAAGATGATGG - Intergenic
1201476231 Y:14384514-14384536 TAGTGAATGTGCAAAGAAAATGG + Intergenic