ID: 1164755938

View in Genome Browser
Species Human (GRCh38)
Location 19:30689621-30689643
Sequence TGCATCCATGTCTCTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164755938_1164755941 5 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755941 19:30689649-30689671 CATGTTTGGAGTGACCAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 141
1164755938_1164755945 21 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755945 19:30689665-30689687 AGCAGGGACCAGGACCATCTGGG 0: 1
1: 0
2: 2
3: 19
4: 228
1164755938_1164755940 4 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755940 19:30689648-30689670 TCATGTTTGGAGTGACCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1164755938_1164755944 20 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755944 19:30689664-30689686 CAGCAGGGACCAGGACCATCTGG 0: 1
1: 0
2: 3
3: 29
4: 320
1164755938_1164755946 22 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755946 19:30689666-30689688 GCAGGGACCAGGACCATCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 222
1164755938_1164755947 23 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755947 19:30689667-30689689 CAGGGACCAGGACCATCTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 229
1164755938_1164755942 11 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755942 19:30689655-30689677 TGGAGTGACCAGCAGGGACCAGG 0: 1
1: 0
2: 1
3: 26
4: 299
1164755938_1164755939 -9 Left 1164755938 19:30689621-30689643 CCTTGGGAAGAGACATGGATGCA No data
Right 1164755939 19:30689635-30689657 ATGGATGCACTTGTCATGTTTGG 0: 1
1: 0
2: 1
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164755938 Original CRISPR TGCATCCATGTCTCTTCCCA AGG (reversed) Intronic
No off target data available for this crispr