ID: 1164758683

View in Genome Browser
Species Human (GRCh38)
Location 19:30710433-30710455
Sequence TGGAGGCTAAGGCGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102693
Summary {0: 1, 1: 31, 2: 801, 3: 10357, 4: 91503}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164758675_1164758683 -4 Left 1164758675 19:30710414-30710436 CCTGTAGTCCCAGCTACTCTGGA 0: 4092
1: 106823
2: 236369
3: 242729
4: 149924
Right 1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG 0: 1
1: 31
2: 801
3: 10357
4: 91503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164758683 Original CRISPR TGGAGGCTAAGGCGGGAGGA TGG Intronic
Too many off-targets to display for this crispr