ID: 1164761544

View in Genome Browser
Species Human (GRCh38)
Location 19:30731961-30731983
Sequence TGTCATTTCAGTCCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164761540_1164761544 -7 Left 1164761540 19:30731945-30731967 CCCACAAAGGAGGTTGTGTCATT No data
Right 1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG No data
1164761539_1164761544 -3 Left 1164761539 19:30731941-30731963 CCTGCCCACAAAGGAGGTTGTGT No data
Right 1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG No data
1164761541_1164761544 -8 Left 1164761541 19:30731946-30731968 CCACAAAGGAGGTTGTGTCATTT No data
Right 1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG No data
1164761536_1164761544 8 Left 1164761536 19:30731930-30731952 CCAACTCAAAACCTGCCCACAAA No data
Right 1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164761544 Original CRISPR TGTCATTTCAGTCCTGGGCA AGG Intergenic
No off target data available for this crispr