ID: 1164767720

View in Genome Browser
Species Human (GRCh38)
Location 19:30784520-30784542
Sequence TGGATGCGTCCAGAACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164767720_1164767729 27 Left 1164767720 19:30784520-30784542 CCAGCGGGTTCTGGACGCATCCA No data
Right 1164767729 19:30784570-30784592 GGTCTTCATTAATTCAGTTAAGG No data
1164767720_1164767724 5 Left 1164767720 19:30784520-30784542 CCAGCGGGTTCTGGACGCATCCA No data
Right 1164767724 19:30784548-30784570 ATCAGCATCTGTTCTCCCCTTGG No data
1164767720_1164767725 6 Left 1164767720 19:30784520-30784542 CCAGCGGGTTCTGGACGCATCCA No data
Right 1164767725 19:30784549-30784571 TCAGCATCTGTTCTCCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164767720 Original CRISPR TGGATGCGTCCAGAACCCGC TGG (reversed) Intergenic
No off target data available for this crispr