ID: 1164769703

View in Genome Browser
Species Human (GRCh38)
Location 19:30799224-30799246
Sequence GTTCACCAGCTCCCCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164769690_1164769703 17 Left 1164769690 19:30799184-30799206 CCTTCTCCCCAGCCTGGCCCCTG No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769695_1164769703 5 Left 1164769695 19:30799196-30799218 CCTGGCCCCTGGACTCCTCTCAC No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769700_1164769703 -10 Left 1164769700 19:30799211-30799233 CCTCTCACTGCTGGTTCACCAGC No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769696_1164769703 0 Left 1164769696 19:30799201-30799223 CCCCTGGACTCCTCTCACTGCTG No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769692_1164769703 11 Left 1164769692 19:30799190-30799212 CCCCAGCCTGGCCCCTGGACTCC No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769699_1164769703 -2 Left 1164769699 19:30799203-30799225 CCTGGACTCCTCTCACTGCTGGT No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769693_1164769703 10 Left 1164769693 19:30799191-30799213 CCCAGCCTGGCCCCTGGACTCCT No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769694_1164769703 9 Left 1164769694 19:30799192-30799214 CCAGCCTGGCCCCTGGACTCCTC No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data
1164769697_1164769703 -1 Left 1164769697 19:30799202-30799224 CCCTGGACTCCTCTCACTGCTGG No data
Right 1164769703 19:30799224-30799246 GTTCACCAGCTCCCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164769703 Original CRISPR GTTCACCAGCTCCCCAGGAT GGG Intergenic
No off target data available for this crispr