ID: 1164770771

View in Genome Browser
Species Human (GRCh38)
Location 19:30807132-30807154
Sequence GATTGTGATAGCTCAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164770771_1164770773 8 Left 1164770771 19:30807132-30807154 CCCAGTTCTGAGCTATCACAATC No data
Right 1164770773 19:30807163-30807185 CTGTGTCGCTGAGCTCTGCTCGG No data
1164770771_1164770774 17 Left 1164770771 19:30807132-30807154 CCCAGTTCTGAGCTATCACAATC No data
Right 1164770774 19:30807172-30807194 TGAGCTCTGCTCGGCAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164770771 Original CRISPR GATTGTGATAGCTCAGAACT GGG (reversed) Intergenic
No off target data available for this crispr