ID: 1164770772

View in Genome Browser
Species Human (GRCh38)
Location 19:30807133-30807155
Sequence TGATTGTGATAGCTCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164770772_1164770774 16 Left 1164770772 19:30807133-30807155 CCAGTTCTGAGCTATCACAATCA No data
Right 1164770774 19:30807172-30807194 TGAGCTCTGCTCGGCAAGTGTGG No data
1164770772_1164770773 7 Left 1164770772 19:30807133-30807155 CCAGTTCTGAGCTATCACAATCA No data
Right 1164770773 19:30807163-30807185 CTGTGTCGCTGAGCTCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164770772 Original CRISPR TGATTGTGATAGCTCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr