ID: 1164771732

View in Genome Browser
Species Human (GRCh38)
Location 19:30815030-30815052
Sequence CAGTGTGACTAGAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164771727_1164771732 -3 Left 1164771727 19:30815010-30815032 CCAAAGGACCCTGAGATAGACAG No data
Right 1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG No data
1164771726_1164771732 0 Left 1164771726 19:30815007-30815029 CCACCAAAGGACCCTGAGATAGA No data
Right 1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164771732 Original CRISPR CAGTGTGACTAGAGAGGAGG AGG Intergenic
No off target data available for this crispr