ID: 1164774818

View in Genome Browser
Species Human (GRCh38)
Location 19:30844752-30844774
Sequence CATTTCCTACCCATGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164774818_1164774823 -6 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774823 19:30844769-30844791 GAAATGCCCCCGGGAAGCAGGGG No data
1164774818_1164774824 -5 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774824 19:30844770-30844792 AAATGCCCCCGGGAAGCAGGGGG No data
1164774818_1164774826 0 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774826 19:30844775-30844797 CCCCCGGGAAGCAGGGGGCCTGG No data
1164774818_1164774821 -8 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774821 19:30844767-30844789 AGGAAATGCCCCCGGGAAGCAGG No data
1164774818_1164774832 28 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774832 19:30844803-30844825 GGAATTGAGATGTTCCAGTCAGG No data
1164774818_1164774822 -7 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774822 19:30844768-30844790 GGAAATGCCCCCGGGAAGCAGGG No data
1164774818_1164774830 7 Left 1164774818 19:30844752-30844774 CCAGGGGACATGGGTAGGAAATG No data
Right 1164774830 19:30844782-30844804 GAAGCAGGGGGCCTGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164774818 Original CRISPR CATTTCCTACCCATGTCCCC TGG (reversed) Intergenic
No off target data available for this crispr