ID: 1164776831

View in Genome Browser
Species Human (GRCh38)
Location 19:30859241-30859263
Sequence AAGGAGTAGCAGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164776825_1164776831 11 Left 1164776825 19:30859207-30859229 CCTTTTGCTTTCCTCCATGATAC No data
Right 1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG No data
1164776827_1164776831 0 Left 1164776827 19:30859218-30859240 CCTCCATGATACTGAATGGAAGA No data
Right 1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG No data
1164776828_1164776831 -3 Left 1164776828 19:30859221-30859243 CCATGATACTGAATGGAAGAAAG No data
Right 1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164776831 Original CRISPR AAGGAGTAGCAGAAGTTGGA TGG Intergenic
No off target data available for this crispr