ID: 1164780007

View in Genome Browser
Species Human (GRCh38)
Location 19:30884522-30884544
Sequence GAAGCTTCTGAGACCCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164780007_1164780010 6 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780010 19:30884551-30884573 ATGCCCCACCACTTGCAAGAGGG No data
1164780007_1164780009 5 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780009 19:30884550-30884572 GATGCCCCACCACTTGCAAGAGG No data
1164780007_1164780015 11 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780015 19:30884556-30884578 CCACCACTTGCAAGAGGGGCAGG No data
1164780007_1164780019 24 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780019 19:30884569-30884591 GAGGGGCAGGTGGTATGGAAAGG No data
1164780007_1164780018 19 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780018 19:30884564-30884586 TGCAAGAGGGGCAGGTGGTATGG No data
1164780007_1164780011 7 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780011 19:30884552-30884574 TGCCCCACCACTTGCAAGAGGGG No data
1164780007_1164780017 14 Left 1164780007 19:30884522-30884544 CCTCACAGGGTCTCAGAAGCTTC No data
Right 1164780017 19:30884559-30884581 CCACTTGCAAGAGGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164780007 Original CRISPR GAAGCTTCTGAGACCCTGTG AGG (reversed) Intergenic
No off target data available for this crispr