ID: 1164780642

View in Genome Browser
Species Human (GRCh38)
Location 19:30888988-30889010
Sequence GGATAAACACAGATATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164780639_1164780642 20 Left 1164780639 19:30888945-30888967 CCCAGTGAGATATGTTTTAGACA No data
Right 1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG No data
1164780640_1164780642 19 Left 1164780640 19:30888946-30888968 CCAGTGAGATATGTTTTAGACAA No data
Right 1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG No data
1164780637_1164780642 26 Left 1164780637 19:30888939-30888961 CCGCCACCCAGTGAGATATGTTT No data
Right 1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG No data
1164780636_1164780642 29 Left 1164780636 19:30888936-30888958 CCACCGCCACCCAGTGAGATATG No data
Right 1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG No data
1164780638_1164780642 23 Left 1164780638 19:30888942-30888964 CCACCCAGTGAGATATGTTTTAG No data
Right 1164780642 19:30888988-30889010 GGATAAACACAGATATAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164780642 Original CRISPR GGATAAACACAGATATAGAT AGG Intergenic
No off target data available for this crispr