ID: 1164781063

View in Genome Browser
Species Human (GRCh38)
Location 19:30893253-30893275
Sequence CTGAAAACACAGATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164781058_1164781063 8 Left 1164781058 19:30893222-30893244 CCATGGTGGGAAAAGGATTGCCA No data
Right 1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164781063 Original CRISPR CTGAAAACACAGATGGAGAA TGG Intergenic
No off target data available for this crispr