ID: 1164785361

View in Genome Browser
Species Human (GRCh38)
Location 19:30926325-30926347
Sequence TTCCCACAGCCCTCCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164785355_1164785361 16 Left 1164785355 19:30926286-30926308 CCCAGCCTGTCCTCCCTTTGATA No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data
1164785359_1164785361 3 Left 1164785359 19:30926299-30926321 CCCTTTGATAAAATTCTCTTCTC No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data
1164785358_1164785361 6 Left 1164785358 19:30926296-30926318 CCTCCCTTTGATAAAATTCTCTT No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data
1164785360_1164785361 2 Left 1164785360 19:30926300-30926322 CCTTTGATAAAATTCTCTTCTCT No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data
1164785356_1164785361 15 Left 1164785356 19:30926287-30926309 CCAGCCTGTCCTCCCTTTGATAA No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data
1164785357_1164785361 11 Left 1164785357 19:30926291-30926313 CCTGTCCTCCCTTTGATAAAATT No data
Right 1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164785361 Original CRISPR TTCCCACAGCCCTCCAGCCA TGG Intergenic
No off target data available for this crispr