ID: 1164788581

View in Genome Browser
Species Human (GRCh38)
Location 19:30957293-30957315
Sequence CACCCTTGGAGGGCAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164788577_1164788581 2 Left 1164788577 19:30957268-30957290 CCTATATTCTACTGTGTCAACTA No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788576_1164788581 10 Left 1164788576 19:30957260-30957282 CCACTCATCCTATATTCTACTGT No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788574_1164788581 12 Left 1164788574 19:30957258-30957280 CCCCACTCATCCTATATTCTACT No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788573_1164788581 15 Left 1164788573 19:30957255-30957277 CCACCCCACTCATCCTATATTCT No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788571_1164788581 17 Left 1164788571 19:30957253-30957275 CCCCACCCCACTCATCCTATATT No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788575_1164788581 11 Left 1164788575 19:30957259-30957281 CCCACTCATCCTATATTCTACTG No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data
1164788572_1164788581 16 Left 1164788572 19:30957254-30957276 CCCACCCCACTCATCCTATATTC No data
Right 1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164788581 Original CRISPR CACCCTTGGAGGGCAAAGAG TGG Intergenic
No off target data available for this crispr