ID: 1164793643

View in Genome Browser
Species Human (GRCh38)
Location 19:31008795-31008817
Sequence CTGGAGTTTCAGATCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164793643_1164793649 18 Left 1164793643 19:31008795-31008817 CCCAGCCTGATCTGAAACTCCAG No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data
1164793643_1164793647 12 Left 1164793643 19:31008795-31008817 CCCAGCCTGATCTGAAACTCCAG No data
Right 1164793647 19:31008830-31008852 ATCAGAATTGTCCTATTCTGAGG No data
1164793643_1164793648 17 Left 1164793643 19:31008795-31008817 CCCAGCCTGATCTGAAACTCCAG No data
Right 1164793648 19:31008835-31008857 AATTGTCCTATTCTGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164793643 Original CRISPR CTGGAGTTTCAGATCAGGCT GGG (reversed) Intergenic
No off target data available for this crispr