ID: 1164793649

View in Genome Browser
Species Human (GRCh38)
Location 19:31008836-31008858
Sequence ATTGTCCTATTCTGAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164793643_1164793649 18 Left 1164793643 19:31008795-31008817 CCCAGCCTGATCTGAAACTCCAG No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data
1164793644_1164793649 17 Left 1164793644 19:31008796-31008818 CCAGCCTGATCTGAAACTCCAGA No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data
1164793642_1164793649 19 Left 1164793642 19:31008794-31008816 CCCCAGCCTGATCTGAAACTCCA No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data
1164793646_1164793649 -1 Left 1164793646 19:31008814-31008836 CCAGAGAGTGAATAGCATCAGAA No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data
1164793645_1164793649 13 Left 1164793645 19:31008800-31008822 CCTGATCTGAAACTCCAGAGAGT No data
Right 1164793649 19:31008836-31008858 ATTGTCCTATTCTGAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164793649 Original CRISPR ATTGTCCTATTCTGAGGACA GGG Intergenic
No off target data available for this crispr