ID: 1164799599

View in Genome Browser
Species Human (GRCh38)
Location 19:31065295-31065317
Sequence TCAGCCCTGCTTGGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164799586_1164799599 17 Left 1164799586 19:31065255-31065277 CCATCTCCCTGCTGTGCCCTGGG No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data
1164799590_1164799599 1 Left 1164799590 19:31065271-31065293 CCCTGGGCCATCTTCCTCTGCCC No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data
1164799589_1164799599 10 Left 1164799589 19:31065262-31065284 CCTGCTGTGCCCTGGGCCATCTT No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data
1164799588_1164799599 11 Left 1164799588 19:31065261-31065283 CCCTGCTGTGCCCTGGGCCATCT No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data
1164799591_1164799599 0 Left 1164799591 19:31065272-31065294 CCTGGGCCATCTTCCTCTGCCCA No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data
1164799592_1164799599 -6 Left 1164799592 19:31065278-31065300 CCATCTTCCTCTGCCCATCAGCC No data
Right 1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164799599 Original CRISPR TCAGCCCTGCTTGGGCCAGG TGG Intergenic
No off target data available for this crispr