ID: 1164803524

View in Genome Browser
Species Human (GRCh38)
Location 19:31097894-31097916
Sequence TGTGGACACCAATGCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164803524_1164803528 2 Left 1164803524 19:31097894-31097916 CCAGAGGAGCATTGGTGTCCACA No data
Right 1164803528 19:31097919-31097941 CTGAATGGCTTTAGGCTGATTGG No data
1164803524_1164803526 -6 Left 1164803524 19:31097894-31097916 CCAGAGGAGCATTGGTGTCCACA No data
Right 1164803526 19:31097911-31097933 TCCACACTCTGAATGGCTTTAGG No data
1164803524_1164803529 22 Left 1164803524 19:31097894-31097916 CCAGAGGAGCATTGGTGTCCACA No data
Right 1164803529 19:31097939-31097961 TGGAAAAATTCTTGACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164803524 Original CRISPR TGTGGACACCAATGCTCCTC TGG (reversed) Intergenic
No off target data available for this crispr