ID: 1164803537

View in Genome Browser
Species Human (GRCh38)
Location 19:31098056-31098078
Sequence AAACTCCTGCTGAATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164803532_1164803537 27 Left 1164803532 19:31098006-31098028 CCTTCATCTCTAGTAATGCTTTA No data
Right 1164803537 19:31098056-31098078 AAACTCCTGCTGAATTAGAGAGG No data
1164803536_1164803537 -8 Left 1164803536 19:31098041-31098063 CCATTAACTAGGGCTAAACTCCT No data
Right 1164803537 19:31098056-31098078 AAACTCCTGCTGAATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164803537 Original CRISPR AAACTCCTGCTGAATTAGAG AGG Intergenic
No off target data available for this crispr