ID: 1164805067

View in Genome Browser
Species Human (GRCh38)
Location 19:31110153-31110175
Sequence TATTATGTTCATTTGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164805067_1164805073 4 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805073 19:31110180-31110202 CAAGTTAGGGAGAGGTGTGCAGG No data
1164805067_1164805070 -10 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805070 19:31110166-31110188 GAACATAATACAGACAAGTTAGG No data
1164805067_1164805076 21 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805076 19:31110197-31110219 TGCAGGCTGATTTGTGGGTCCGG No data
1164805067_1164805072 -4 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805072 19:31110172-31110194 AATACAGACAAGTTAGGGAGAGG No data
1164805067_1164805078 30 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805078 19:31110206-31110228 ATTTGTGGGTCCGGTGTGGCAGG No data
1164805067_1164805077 26 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805077 19:31110202-31110224 GCTGATTTGTGGGTCCGGTGTGG No data
1164805067_1164805071 -9 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805071 19:31110167-31110189 AACATAATACAGACAAGTTAGGG No data
1164805067_1164805075 16 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805075 19:31110192-31110214 AGGTGTGCAGGCTGATTTGTGGG No data
1164805067_1164805074 15 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805074 19:31110191-31110213 GAGGTGTGCAGGCTGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164805067 Original CRISPR TATTATGTTCATTTGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr