ID: 1164805077

View in Genome Browser
Species Human (GRCh38)
Location 19:31110202-31110224
Sequence GCTGATTTGTGGGTCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164805067_1164805077 26 Left 1164805067 19:31110153-31110175 CCTCCCAGCAAATGAACATAATA No data
Right 1164805077 19:31110202-31110224 GCTGATTTGTGGGTCCGGTGTGG No data
1164805068_1164805077 23 Left 1164805068 19:31110156-31110178 CCCAGCAAATGAACATAATACAG No data
Right 1164805077 19:31110202-31110224 GCTGATTTGTGGGTCCGGTGTGG No data
1164805069_1164805077 22 Left 1164805069 19:31110157-31110179 CCAGCAAATGAACATAATACAGA No data
Right 1164805077 19:31110202-31110224 GCTGATTTGTGGGTCCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164805077 Original CRISPR GCTGATTTGTGGGTCCGGTG TGG Intergenic
No off target data available for this crispr