ID: 1164805441

View in Genome Browser
Species Human (GRCh38)
Location 19:31112729-31112751
Sequence CATTTGATGCAGAGTCTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164805437_1164805441 -6 Left 1164805437 19:31112712-31112734 CCCCTGTTTGTGAGCTACATTTG No data
Right 1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG No data
1164805439_1164805441 -8 Left 1164805439 19:31112714-31112736 CCTGTTTGTGAGCTACATTTGAT No data
Right 1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG No data
1164805438_1164805441 -7 Left 1164805438 19:31112713-31112735 CCCTGTTTGTGAGCTACATTTGA No data
Right 1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG No data
1164805436_1164805441 -5 Left 1164805436 19:31112711-31112733 CCCCCTGTTTGTGAGCTACATTT No data
Right 1164805441 19:31112729-31112751 CATTTGATGCAGAGTCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164805441 Original CRISPR CATTTGATGCAGAGTCTAGG CGG Intergenic
No off target data available for this crispr