ID: 1164807807

View in Genome Browser
Species Human (GRCh38)
Location 19:31130311-31130333
Sequence GAGAATGCTGCAATTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164807801_1164807807 9 Left 1164807801 19:31130279-31130301 CCTCTCCTGTATTCACTCTACTT No data
Right 1164807807 19:31130311-31130333 GAGAATGCTGCAATTTTTGGGGG No data
1164807802_1164807807 4 Left 1164807802 19:31130284-31130306 CCTGTATTCACTCTACTTTCTTT No data
Right 1164807807 19:31130311-31130333 GAGAATGCTGCAATTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164807807 Original CRISPR GAGAATGCTGCAATTTTTGG GGG Intergenic
No off target data available for this crispr