ID: 1164815694

View in Genome Browser
Species Human (GRCh38)
Location 19:31200780-31200802
Sequence ACCAACAGCCCACACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164815694_1164815703 9 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815703 19:31200812-31200834 CTGTGCATGTGTGTGGGAAGGGG No data
1164815694_1164815700 3 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815700 19:31200806-31200828 GGGAGGCTGTGCATGTGTGTGGG No data
1164815694_1164815706 18 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815706 19:31200821-31200843 TGTGTGGGAAGGGGGGTGCATGG No data
1164815694_1164815701 7 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815701 19:31200810-31200832 GGCTGTGCATGTGTGTGGGAAGG No data
1164815694_1164815707 19 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815707 19:31200822-31200844 GTGTGGGAAGGGGGGTGCATGGG No data
1164815694_1164815704 10 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815704 19:31200813-31200835 TGTGCATGTGTGTGGGAAGGGGG No data
1164815694_1164815699 2 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815699 19:31200805-31200827 TGGGAGGCTGTGCATGTGTGTGG No data
1164815694_1164815705 11 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815705 19:31200814-31200836 GTGCATGTGTGTGGGAAGGGGGG No data
1164815694_1164815702 8 Left 1164815694 19:31200780-31200802 CCACCACAGTGTGGGCTGTTGGT No data
Right 1164815702 19:31200811-31200833 GCTGTGCATGTGTGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164815694 Original CRISPR ACCAACAGCCCACACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr