ID: 1164817871

View in Genome Browser
Species Human (GRCh38)
Location 19:31220043-31220065
Sequence CTTGTCAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164817863_1164817871 -7 Left 1164817863 19:31220027-31220049 CCCACTACCCATTTACCTTGTCA No data
Right 1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG No data
1164817864_1164817871 -8 Left 1164817864 19:31220028-31220050 CCACTACCCATTTACCTTGTCAA No data
Right 1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164817871 Original CRISPR CTTGTCAAGGCCAAGGTGGA TGG Intergenic
No off target data available for this crispr