ID: 1164818014

View in Genome Browser
Species Human (GRCh38)
Location 19:31221541-31221563
Sequence GATATCATCTGAAGGTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164818009_1164818014 3 Left 1164818009 19:31221515-31221537 CCACATTCCTTCCACAGCATCAC No data
Right 1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG No data
1164818008_1164818014 23 Left 1164818008 19:31221495-31221517 CCGAGGTCATCAGATACACTCCA No data
Right 1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG No data
1164818011_1164818014 -8 Left 1164818011 19:31221526-31221548 CCACAGCATCACCACGATATCAT No data
Right 1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG No data
1164818010_1164818014 -4 Left 1164818010 19:31221522-31221544 CCTTCCACAGCATCACCACGATA No data
Right 1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG No data
1164818007_1164818014 24 Left 1164818007 19:31221494-31221516 CCCGAGGTCATCAGATACACTCC No data
Right 1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164818014 Original CRISPR GATATCATCTGAAGGTTAGC TGG Intergenic
No off target data available for this crispr