ID: 1164818764

View in Genome Browser
Species Human (GRCh38)
Location 19:31227685-31227707
Sequence TTTTCACTCAGTAAAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164818759_1164818764 14 Left 1164818759 19:31227648-31227670 CCTGTGGGCTTTATATTGCGTAC No data
Right 1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG No data
1164818761_1164818764 -9 Left 1164818761 19:31227671-31227693 CCCAAAACTCTTCTTTTTCACTC No data
Right 1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG No data
1164818760_1164818764 -8 Left 1164818760 19:31227670-31227692 CCCCAAAACTCTTCTTTTTCACT No data
Right 1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG No data
1164818762_1164818764 -10 Left 1164818762 19:31227672-31227694 CCAAAACTCTTCTTTTTCACTCA No data
Right 1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG No data
1164818758_1164818764 17 Left 1164818758 19:31227645-31227667 CCACCTGTGGGCTTTATATTGCG No data
Right 1164818764 19:31227685-31227707 TTTTCACTCAGTAAAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164818764 Original CRISPR TTTTCACTCAGTAAAGTTGG AGG Intergenic
No off target data available for this crispr