ID: 1164820126

View in Genome Browser
Species Human (GRCh38)
Location 19:31243602-31243624
Sequence CTCAAATAGCAGAAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164820117_1164820126 9 Left 1164820117 19:31243570-31243592 CCGCCCTGCCGCCTGCATATGGG No data
Right 1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG No data
1164820122_1164820126 -2 Left 1164820122 19:31243581-31243603 CCTGCATATGGGATGAGTCCTCT No data
Right 1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG No data
1164820121_1164820126 1 Left 1164820121 19:31243578-31243600 CCGCCTGCATATGGGATGAGTCC No data
Right 1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG No data
1164820119_1164820126 6 Left 1164820119 19:31243573-31243595 CCCTGCCGCCTGCATATGGGATG No data
Right 1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG No data
1164820120_1164820126 5 Left 1164820120 19:31243574-31243596 CCTGCCGCCTGCATATGGGATGA No data
Right 1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164820126 Original CRISPR CTCAAATAGCAGAAGCAGAG GGG Intergenic
No off target data available for this crispr