ID: 1164820175

View in Genome Browser
Species Human (GRCh38)
Location 19:31243868-31243890
Sequence TGTGGAATACACTTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164820170_1164820175 29 Left 1164820170 19:31243816-31243838 CCTCATCTGCATTTGGAAACTTG No data
Right 1164820175 19:31243868-31243890 TGTGGAATACACTTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164820175 Original CRISPR TGTGGAATACACTTGGAGGA GGG Intergenic
No off target data available for this crispr