ID: 1164822584

View in Genome Browser
Species Human (GRCh38)
Location 19:31261684-31261706
Sequence CTCCACTTGTAACGTATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164822584_1164822591 12 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822591 19:31261719-31261741 TTTCCTGCTTACAGAAACCGGGG No data
1164822584_1164822592 13 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822592 19:31261720-31261742 TTCCTGCTTACAGAAACCGGGGG No data
1164822584_1164822589 10 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822589 19:31261717-31261739 GGTTTCCTGCTTACAGAAACCGG No data
1164822584_1164822590 11 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822590 19:31261718-31261740 GTTTCCTGCTTACAGAAACCGGG No data
1164822584_1164822594 18 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822594 19:31261725-31261747 GCTTACAGAAACCGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164822584 Original CRISPR CTCCACTTGTAACGTATATG TGG (reversed) Intergenic