ID: 1164822592

View in Genome Browser
Species Human (GRCh38)
Location 19:31261720-31261742
Sequence TTCCTGCTTACAGAAACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164822584_1164822592 13 Left 1164822584 19:31261684-31261706 CCACATATACGTTACAAGTGGAG No data
Right 1164822592 19:31261720-31261742 TTCCTGCTTACAGAAACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164822592 Original CRISPR TTCCTGCTTACAGAAACCGG GGG Intergenic