ID: 1164822592 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:31261720-31261742 |
| Sequence | TTCCTGCTTACAGAAACCGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164822584_1164822592 | 13 | Left | 1164822584 | 19:31261684-31261706 | CCACATATACGTTACAAGTGGAG | No data | ||
| Right | 1164822592 | 19:31261720-31261742 | TTCCTGCTTACAGAAACCGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164822592 | Original CRISPR | TTCCTGCTTACAGAAACCGG GGG | Intergenic | ||