ID: 1164823458

View in Genome Browser
Species Human (GRCh38)
Location 19:31267371-31267393
Sequence CTCCATGTTCAAATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164823452_1164823458 3 Left 1164823452 19:31267345-31267367 CCTCTCTCAGAACAAAACCATAG No data
Right 1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG No data
1164823450_1164823458 11 Left 1164823450 19:31267337-31267359 CCTCAGACCCTCTCTCAGAACAA No data
Right 1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG No data
1164823451_1164823458 4 Left 1164823451 19:31267344-31267366 CCCTCTCTCAGAACAAAACCATA No data
Right 1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164823458 Original CRISPR CTCCATGTTCAAATGGGCCA TGG Intergenic
No off target data available for this crispr