ID: 1164826856

View in Genome Browser
Species Human (GRCh38)
Location 19:31290311-31290333
Sequence CACCCTCCTGGCTCTTGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164826850_1164826856 11 Left 1164826850 19:31290277-31290299 CCCTCAGAGAACATGACAAATCA 0: 1
1: 0
2: 3
3: 15
4: 413
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826851_1164826856 10 Left 1164826851 19:31290278-31290300 CCTCAGAGAACATGACAAATCAA 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826845_1164826856 30 Left 1164826845 19:31290258-31290280 CCAAACACATTCCCCCTGGCCCT 0: 1
1: 0
2: 4
3: 45
4: 465
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826848_1164826856 17 Left 1164826848 19:31290271-31290293 CCCTGGCCCTCAGAGAACATGAC 0: 1
1: 0
2: 2
3: 27
4: 223
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826846_1164826856 19 Left 1164826846 19:31290269-31290291 CCCCCTGGCCCTCAGAGAACATG 0: 1
1: 0
2: 2
3: 28
4: 257
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826849_1164826856 16 Left 1164826849 19:31290272-31290294 CCTGGCCCTCAGAGAACATGACA 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223
1164826847_1164826856 18 Left 1164826847 19:31290270-31290292 CCCCTGGCCCTCAGAGAACATGA 0: 1
1: 0
2: 1
3: 15
4: 225
Right 1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG 0: 1
1: 0
2: 1
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164826856 Original CRISPR CACCCTCCTGGCTCTTGACC GGG Intronic
902374234 1:16022809-16022831 CACCCTCCTGTCATTTGTCCAGG + Intronic
902650425 1:17833759-17833781 CAACCACCTGGCTCTCTACCTGG + Intergenic
902965034 1:19994996-19995018 GACCCTCCTGCCTCCTGACTAGG - Intergenic
904072478 1:27812178-27812200 CATCCTCCTGGCTCTGCATCTGG - Exonic
904267474 1:29326000-29326022 CACCATCCTGGCTTTTGGCAGGG + Intronic
904875429 1:33651211-33651233 CATCCTCCTAGCTCCTGTCCTGG - Intronic
905645090 1:39619722-39619744 CACCATCCTGGCTCTGGCCTAGG - Intergenic
906098286 1:43239022-43239044 CCGCCTCCTGGCTCTGGGCCTGG + Intronic
906151718 1:43591531-43591553 CTCCCTGCTGCGTCTTGACCTGG - Exonic
908160413 1:61402358-61402380 AAGCTCCCTGGCTCTTGACCAGG + Intronic
908938211 1:69400922-69400944 CACACTCCTGGCACTTGGGCTGG + Intergenic
915252347 1:154599651-154599673 CATCCTACTGGCTCTTTCCCTGG + Intronic
915916397 1:159943400-159943422 CAGCCCCCTGGCTGATGACCAGG + Exonic
918197523 1:182236066-182236088 CAGCCTCCTGCCTCCTGACTTGG - Intergenic
918971700 1:191428141-191428163 CAGCCTCCTGGCTCTCAAGCAGG - Intergenic
919351094 1:196454987-196455009 TTCCTCCCTGGCTCTTGACCAGG + Intronic
919653742 1:200177876-200177898 CACCATTCTGTCTCTAGACCAGG + Intergenic
920160767 1:203996261-203996283 CACCATCCTGGCGCCTGACTGGG + Intergenic
920231837 1:204475825-204475847 CATCCTCCTGGCTCTGGGCCAGG + Intronic
920502819 1:206496256-206496278 CTCCCTCCTGGCTGCTGGCCAGG + Exonic
920867206 1:209762975-209762997 CACCCTACTGGCTCTTCAGAAGG + Intronic
922716077 1:227872872-227872894 CACCCCCATGCCTCTTGACTAGG + Intergenic
1065264076 10:23957023-23957045 CACCCCACTGGCTCCTCACCAGG + Intronic
1066604026 10:37141651-37141673 CATCCTCCTGACTCTTCACCTGG - Intronic
1067084526 10:43230749-43230771 CACCCCCACGGCTCTTGCCCAGG + Intronic
1067315419 10:45156711-45156733 CATCCTCCTGACTCTTCACCTGG - Intergenic
1067557919 10:47285333-47285355 TACCCTCCTGACTCATGATCGGG + Intergenic
1068952970 10:62795894-62795916 GCCCCATCTGGCTCTTGACCTGG + Intergenic
1069123831 10:64604761-64604783 CACCTGCCTGGCTGTTGAACTGG - Intergenic
1069914273 10:71777799-71777821 CACCATCCAGGCACTGGACCTGG + Intronic
1070731762 10:78833683-78833705 CTCCCTCCTGCCCCTTGACCCGG + Intergenic
1071013432 10:80966559-80966581 CATCTTCCTGGCTCTACACCAGG - Intergenic
1072578178 10:96719151-96719173 CAGCCTCCTGGCTCTCCAGCTGG - Intronic
1074608776 10:115001239-115001261 CACCCTCCTTGCACTTGCTCAGG + Intergenic
1075087166 10:119421476-119421498 CAGGCTCCTGGCTCTTGGCCTGG + Intronic
1075559326 10:123456987-123457009 CACACTCCTGGCACGTGACAGGG - Intergenic
1079969114 11:27014880-27014902 CAGCCTTCTTACTCTTGACCTGG + Intergenic
1083860741 11:65418679-65418701 CCCTCTCCTGCCTCCTGACCTGG + Intergenic
1084568345 11:69944279-69944301 CACCCTGCAGGCTCCTGAGCAGG - Intergenic
1087873427 11:103326779-103326801 CAGCCTGCTGTCTCTTGGCCTGG + Intronic
1089168629 11:116497386-116497408 TACCCTCTGGGCTCTTGCCCTGG - Intergenic
1092148223 12:6229334-6229356 CCCCATCCTGGCTTGTGACCTGG + Intronic
1092173578 12:6388372-6388394 CACCCTCCTGTCTGCTGTCCTGG + Intronic
1093441616 12:19204111-19204133 TACCCTCCTGCCTCTTAACATGG - Intronic
1096693868 12:53336685-53336707 CACCCACCTGCCTCTAGATCAGG + Intronic
1099639920 12:85273622-85273644 CACCTTCCTGGCTCCCGGCCTGG - Intergenic
1099780127 12:87183427-87183449 CTCCCTCCTGGCTGTTGTCCTGG - Intergenic
1100269918 12:93014793-93014815 TGCCCTCCTGCCTCTTGTCCTGG - Intergenic
1103730808 12:123026627-123026649 GACCCTCCTGGCCCCTGTCCTGG - Intronic
1103846856 12:123907916-123907938 CTCCCTCCTGGCTGTTGCCCTGG + Intronic
1104814799 12:131639512-131639534 CACCCTTCTGGGTCATGTCCAGG + Intergenic
1105042706 12:132973326-132973348 CACCCTCCTGCCTTTTGAATTGG - Intergenic
1105224831 13:18422711-18422733 CATCCTTCTGACTCTTTACCTGG - Intronic
1105892625 13:24692473-24692495 CAGCCTCCAGGTTCTTCACCAGG - Exonic
1105971109 13:25429864-25429886 CACCCTGCTGACTCCTGCCCAGG - Intronic
1110455893 13:75690030-75690052 CACCTTCCTGGCTCTTTAGTCGG - Intronic
1112338955 13:98537070-98537092 CACCATCCTGGCTCTCTCCCTGG - Intronic
1113534241 13:111051578-111051600 CACCCTCCTGGCGTCTCACCAGG - Intergenic
1113650678 13:112032169-112032191 CACCCTCCTGGGTAATTACCTGG + Intergenic
1115531664 14:34333608-34333630 CACCCTCCTTGCTCTTCTCTGGG - Intronic
1120167667 14:81219304-81219326 CACACGCCTGGCTCTTGCCTCGG + Intronic
1120822545 14:88926232-88926254 CACCCTCCTCCCTCAGGACCTGG - Intergenic
1121692371 14:95886907-95886929 CAGCCCCCTGGCTCTGGGCCTGG - Intergenic
1122374548 14:101249205-101249227 CAGCCTCCTTCCTGTTGACCAGG - Intergenic
1122454776 14:101841810-101841832 CAGCCTCCTGGCTGTCCACCTGG - Intronic
1123416064 15:20096295-20096317 CAACCTCCTGGCTCTGCTCCAGG + Intergenic
1123525402 15:21103404-21103426 CAACCTCCTGGCTCTGCTCCAGG + Intergenic
1124645324 15:31434323-31434345 CACCTTCCTGGCTCTCCAACTGG - Intronic
1125149160 15:36511469-36511491 CACCCTCTGGCCTCTTGAGCGGG - Intergenic
1125433760 15:39624931-39624953 GAGCCTCCTGGCTGCTGACCTGG - Intronic
1127142998 15:55995720-55995742 GCCCCTCCTAGCTGTTGACCGGG - Intergenic
1128360807 15:66960284-66960306 TACCCTCCTGGCTTCTGACTGGG - Intergenic
1130888137 15:88110894-88110916 CTCCCACATGGCTCTGGACCTGG - Intronic
1133712536 16:8415174-8415196 CTCACTCTTGGCTGTTGACCTGG - Intergenic
1133958441 16:10468531-10468553 CTCCATCCCTGCTCTTGACCTGG - Intronic
1134057801 16:11181295-11181317 CACACTCCTGGCTCTTCCTCTGG - Exonic
1136005948 16:27329135-27329157 CTCCCTCCTCTCTCTTGCCCTGG + Intronic
1136573597 16:31110567-31110589 CAGCCCCCAGGCCCTTGACCCGG - Intronic
1137722920 16:50638399-50638421 CACCCTCCTGGCCCCTGCCTCGG + Exonic
1139338825 16:66253747-66253769 CAGCCTCCTGCCTCTGGACTTGG + Intergenic
1141438036 16:84012058-84012080 CACACTCCTGGCTCCAGAACTGG + Intronic
1141490632 16:84370274-84370296 CTCCCACCTGGCTGTGGACCGGG + Intronic
1141656836 16:85421199-85421221 CACCCTCCTGTCTCCTGGACGGG + Intergenic
1142360008 16:89621456-89621478 CTCTCTTCTGGCTCCTGACCAGG - Intronic
1143025298 17:3938015-3938037 CACCTACCTGGCTCTTTACCCGG - Intronic
1145195528 17:20890591-20890613 CATCCTTCTGCCTCTTTACCTGG + Intronic
1146175857 17:30666264-30666286 CAGCCTCCTGGCTTCTGCCCTGG - Intergenic
1146349309 17:32082369-32082391 CAGCCTCCTGGCTTCTGCCCTGG - Intergenic
1147430897 17:40370187-40370209 CCACCTCCTGGCTCTTGCCTTGG + Intergenic
1147606036 17:41774159-41774181 CAGTCTCCTGGCGGTTGACCTGG - Intronic
1148794030 17:50188671-50188693 CCCCATCCTGGCCCTTCACCCGG - Intronic
1148858981 17:50594134-50594156 CCCCCTCCTAGCTCTTGGCAAGG - Intronic
1150107396 17:62472435-62472457 CAGCCTCCTGGCTTTTATCCTGG - Intronic
1151956193 17:77381342-77381364 CAGACTGCTGGCTGTTGACCTGG - Intronic
1152317828 17:79591117-79591139 CCCCATCCTGGCTCTTCTCCTGG - Intergenic
1154528526 18:15316810-15316832 CATCCTTCTGACTCTTTACCTGG + Intergenic
1155335761 18:24763938-24763960 CACCCACCTGGCTCATGTACAGG + Intergenic
1156850366 18:41718835-41718857 CACCATCTGGGCTCTTGAGCTGG - Intergenic
1158945311 18:62442529-62442551 CACCATCCTGCATCTGGACCTGG + Intergenic
1161085197 19:2332002-2332024 CACCCTCCGGGCTCGGCACCGGG + Intronic
1161611187 19:5243901-5243923 CTCCCTGCTGCGTCTTGACCTGG + Exonic
1163087989 19:14996708-14996730 CACTCTCCTGGCTCTTAGCCTGG + Intronic
1164521186 19:28981617-28981639 CTCCCTCCTGGCTGTTAGCCAGG - Intergenic
1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG + Intronic
1164902293 19:31938495-31938517 CTCCCTCCAGGCTCTTGCCATGG + Intergenic
1165454683 19:35903762-35903784 CACTCTCCAGGCTCTTGTTCCGG + Exonic
1166314606 19:41982040-41982062 CAGCCTCCAGGTTCTTCACCAGG + Exonic
1166980582 19:46629852-46629874 CGTCCTCCTGGCTCTGGCCCTGG + Intergenic
927361536 2:22240317-22240339 AAAAGTCCTGGCTCTTGACCAGG - Intergenic
928220528 2:29399447-29399469 CACCCTCGTGCCTTTTGCCCAGG - Intronic
929812305 2:45200954-45200976 CACCATCCAGGCACTTTACCTGG + Intergenic
932720234 2:74133495-74133517 CACCCACATGGCTCTTGTCCTGG + Intronic
934323168 2:91984602-91984624 CACAGTCCTGGCCCTGGACCTGG + Intergenic
934526766 2:95056873-95056895 GTCCCTCCTGGCGCCTGACCGGG - Intergenic
937499645 2:122463992-122464014 CTCCCTGCTGTCTCTTGACCAGG - Intergenic
938527635 2:132148272-132148294 CATCCTTCTGACTCTTTACCTGG + Intronic
939818571 2:146927478-146927500 CCCCCTTCTGGCTCTGGACTGGG - Intergenic
939878503 2:147604013-147604035 CACCCTTCCGGCTCTGGATCTGG - Intergenic
940987202 2:160062056-160062078 CACCCTCCTGGCTCCTGCGGGGG - Intronic
947589882 2:231379533-231379555 CAGCCTCCTGGGCCTTGTCCAGG - Intergenic
948505675 2:238425906-238425928 CACACCCCTGGCTCCTGGCCTGG + Intergenic
949063685 2:241976074-241976096 CACCTCCCAGCCTCTTGACCTGG - Intergenic
1168819809 20:765297-765319 CGCCCTGGTGGCTCTTGCCCAGG - Exonic
1171028403 20:21653822-21653844 TGCCCTCCTGGCTGTTGGCCTGG + Intergenic
1171566300 20:26193320-26193342 CATCCTCCTGATTCTTCACCTGG - Intergenic
1173820867 20:46019556-46019578 CAGCCTCTTGTTTCTTGACCTGG - Intergenic
1175213341 20:57375531-57375553 CACCCTCATGGCTCTTTTCTGGG + Intronic
1175702415 20:61149452-61149474 CACCCTCCTGCCTCTTCCCAGGG + Intergenic
1175954681 20:62603247-62603269 CACCTCCCTGGCTCTTTCCCAGG + Intergenic
1176096929 20:63348624-63348646 GCACCTCCTGGCTCTTGTCCCGG - Intronic
1176768881 21:13051729-13051751 CATCCTTCTGACTCTTTACCTGG - Intergenic
1178678199 21:34648750-34648772 CATTCTCCTGGTTCTTGAGCCGG + Intergenic
1178686002 21:34711126-34711148 CAACCACCTGGCTCTGGCCCTGG - Intronic
1179047147 21:37856102-37856124 CACCCTCCTGTCTCTGGCCATGG - Intronic
1179233808 21:39527885-39527907 CAGCATTCTGGCTCTTGGCCAGG + Intergenic
1179454636 21:41490742-41490764 CTCCCTCCTGGCCCATGAGCTGG - Intronic
1180244626 21:46538921-46538943 CACCCTCCTGCCCTTTGTCCTGG + Intronic
1180610717 22:17095977-17095999 CACCCTCCTCTCTCTTGAGAGGG - Intronic
1180625422 22:17190750-17190772 CACCCTCCTGCCACTGGCCCTGG + Intronic
1180636644 22:17267173-17267195 CAACCTCCTGGTTCTTCACTAGG + Intergenic
1181485078 22:23225461-23225483 CATCCTCCAGGCTCTTGCACGGG + Intronic
1182503646 22:30766561-30766583 CTCCCTCCACGCTCTTGGCCTGG + Intronic
1183161260 22:36114857-36114879 CCCCCACCTGGCTCTGGGCCTGG + Intergenic
1183164116 22:36134562-36134584 CGCCCTCCTGGTGCGTGACCTGG - Intergenic
1183171793 22:36193865-36193887 CACCTTACTGCCTCCTGACCTGG + Intronic
1183656495 22:39188487-39188509 TACCATCCTACCTCTTGACCTGG + Intergenic
1183910376 22:41074744-41074766 CGCCATCCTGCCTCTGGACCTGG - Intergenic
1184101822 22:42344785-42344807 CTCCGTCCTGGCTCTGGGCCTGG + Intergenic
1184993835 22:48188224-48188246 CACCCACCTGGCTCGTGGGCTGG - Intergenic
1185183031 22:49373899-49373921 CCGCCTCCTGGCTCAGGACCCGG - Intergenic
949575168 3:5331731-5331753 GAACCTCCTGGTTCCTGACCAGG - Intergenic
953683122 3:45054553-45054575 CTCCCTCCTAGCACTTTACCTGG + Intergenic
953851985 3:46471556-46471578 CTCCCTCAGGGCTGTTGACCAGG + Intronic
953871425 3:46630380-46630402 CACCCACCAGGCCCATGACCAGG - Intergenic
954218224 3:49136160-49136182 CAGCCTCCTGGCCCTTCACCTGG + Intergenic
954369394 3:50162300-50162322 CACCCTTCTGGCTCTAGACCTGG - Intronic
954698069 3:52437968-52437990 CACCTTCCTGGCTCTGGCCCAGG + Exonic
954806907 3:53225854-53225876 CACCCACCTGGCAGTTAACCGGG - Exonic
954873236 3:53783890-53783912 CAGTCTCCTGCTTCTTGACCAGG - Intronic
955982989 3:64545925-64545947 CAGCCCCCTGGCTCTGGACCAGG - Intronic
956210635 3:66798236-66798258 CTCCCTCCTTGCTGTTGATCGGG + Intergenic
961306507 3:125961433-125961455 GGCCCTCCTGGGTCCTGACCAGG + Intergenic
961623823 3:128245400-128245422 GGCCCTCCTGCCCCTTGACCTGG + Intronic
961693011 3:128684036-128684058 CCCACTCCTGCCTCTTGACCAGG - Intergenic
961900183 3:130202649-130202671 CCCCCTCCTGGCTCTTTCACGGG + Intergenic
962995640 3:140625547-140625569 CACCCTCCTGAGACTAGACCAGG + Intergenic
963160806 3:142149329-142149351 CAAACTCCTGGGCCTTGACCGGG - Exonic
965012088 3:163107205-163107227 CCCCCTCCTGGCTGTTTACCTGG + Intergenic
970585761 4:17512329-17512351 CACCCTCCTCGCCCTTAGCCCGG - Intergenic
973337405 4:48970610-48970632 GAGCCTCCTGGCTCTTGGACTGG + Intergenic
975744930 4:77466431-77466453 CACCCTCCTGGAACTTGCGCTGG - Intergenic
980266492 4:130523763-130523785 CACCCTCCTGGCTGTTTTCATGG + Intergenic
983488727 4:168362464-168362486 CACCAGGCTGGCTCTTGAGCTGG - Intronic
985732289 5:1556108-1556130 CCCCTTCCTGGATCATGACCCGG - Intergenic
986580210 5:9257917-9257939 CACCCTCCTTGCCCTTTACTTGG - Intronic
987114226 5:14713717-14713739 CATCCTGCTGCCTCTGGACCAGG + Intronic
988456555 5:31392231-31392253 TACCCTAGTGGTTCTTGACCAGG + Intergenic
990108394 5:52292930-52292952 CCCCCTCCTGGCTCTTTTCATGG + Intergenic
991291151 5:65035060-65035082 CTCCAGCCTGGCTCTGGACCCGG + Intergenic
992038808 5:72808484-72808506 GACCCTCCTGCCTCTTGACTGGG - Intergenic
993401381 5:87456952-87456974 CACCCACCTGGCTGCTGTCCAGG - Intergenic
994115877 5:96060873-96060895 CACCCTGCTAGACCTTGACCTGG - Intergenic
996255925 5:121402967-121402989 CACCCTCCTGGCTTTTTTCATGG - Intergenic
996336919 5:122394143-122394165 CCCCCTCCTGCCACTTAACCAGG - Intronic
997753615 5:136373711-136373733 CTCCCTCCAGGTTCATGACCAGG - Intronic
999762410 5:154712838-154712860 CTGCCTCCTGGCTCTGGCCCGGG - Intergenic
999966992 5:156820466-156820488 CCCTCTCCTAGCTCTTCACCAGG - Intergenic
1000350532 5:160349296-160349318 CACCATCCTGGCTCTCAAGCAGG - Exonic
1001109434 5:168883587-168883609 CAGCCTCTTGGCTCGTGGCCTGG - Intronic
1001252961 5:170162578-170162600 CAGCCTCCTGGGGCTTGAGCAGG + Intergenic
1001861609 5:175060484-175060506 AAGTCTCCTGGCTCTTGCCCTGG - Intergenic
1002427613 5:179185445-179185467 CCCTCTCCTGGCTCCTGGCCAGG + Intronic
1002639608 5:180624549-180624571 CACCCTTCAGGCTCAGGACCCGG + Intronic
1003618924 6:7680244-7680266 CAGCTTCCTTACTCTTGACCTGG + Intergenic
1006154251 6:32005772-32005794 CCACCTCCTGCCTCTTGCCCCGG + Intergenic
1007665009 6:43508832-43508854 TGCCCTCGTGGCTCTGGACCTGG - Exonic
1010144209 6:72647403-72647425 CAGCCTTCTGTCTCCTGACCAGG - Intronic
1011664513 6:89621744-89621766 CATCCTCCTAGGTCTTGTCCTGG - Intronic
1018466563 6:164051839-164051861 TTCCCTCCTGGCTCTGGCCCTGG - Intergenic
1018619254 6:165714631-165714653 CACCCTCCAGGCTCTAACCCTGG - Intronic
1018994383 6:168700138-168700160 CGGCCTCCTGGCTCCTGGCCTGG + Intergenic
1019152602 6:170018930-170018952 CACCCTCCTGCCTCCTCTCCCGG - Intergenic
1019190939 6:170250259-170250281 CACCCTCCTGCCTCTGGGCCTGG + Intergenic
1019210485 6:170400889-170400911 ATCCTTCCTGGCACTTGACCTGG - Intronic
1019328804 7:452768-452790 GACCCTCCTGGCTCAGGCCCTGG - Intergenic
1020114244 7:5466752-5466774 CTCCCTCCTGCCTCCTGCCCAGG - Intronic
1020130437 7:5556169-5556191 CACCCGCCTGGCTCTGGGGCCGG + Intronic
1021144490 7:17068170-17068192 CATCCTCCTGGCTGCTGATCTGG + Intergenic
1022597038 7:31722654-31722676 CACCATCCTGCTTCTTCACCTGG - Intergenic
1024037809 7:45523672-45523694 CACCATCCTGCCTCTTGCTCTGG - Intergenic
1024755573 7:52526108-52526130 CACCCTCCATGCTCTTGTGCAGG - Intergenic
1028477399 7:91266260-91266282 CACCATCCTGGCGCTGGGCCAGG + Exonic
1028523946 7:91762470-91762492 CACCCTCCTGAGTCTAAACCAGG + Intronic
1034266692 7:149784540-149784562 CATCCTCCAGGCTCTGGAGCAGG - Intergenic
1035634086 8:1130600-1130622 CACCCCCCTGGGTGTTTACCAGG + Intergenic
1036602824 8:10278293-10278315 CAGCATACTTGCTCTTGACCTGG + Intronic
1037697574 8:21238796-21238818 CATCCTCCTGGCCCCTGTCCTGG - Intergenic
1037912671 8:22753267-22753289 CTCCCTCCTGACTCCTGAGCAGG - Intronic
1037986125 8:23291743-23291765 CACCCTGCAGGCCCTAGACCTGG + Intronic
1039024224 8:33240225-33240247 CACCTTCCTGGCTGGTGAGCAGG + Intergenic
1040876598 8:52158870-52158892 CACCCTCCGGGCTCTTGGACTGG + Intronic
1044849062 8:96409923-96409945 AAGCCTGCTGGCTCTTGAGCTGG - Intergenic
1047442222 8:124888361-124888383 CTCCCTCCTGGCACTAGATCAGG - Intergenic
1048931071 8:139315671-139315693 CACCCTCCTGGACCTTTTCCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049773152 8:144392996-144393018 CGCCCTCCTGGCTCGTGCTCTGG + Exonic
1050561105 9:6834973-6834995 CACCATCCTGCATCTGGACCTGG + Intronic
1051498347 9:17749950-17749972 CACACTCATGGCTCTTTACTTGG + Intronic
1054416383 9:64879154-64879176 CATCCTTCTGACTCTTTACCTGG + Intergenic
1058492732 9:105519776-105519798 CACCTTCGTGGCTCTGGATCCGG + Intronic
1059533412 9:115058920-115058942 CACCCTCCTGGGTCTGGGGCTGG + Intronic
1059539714 9:115118306-115118328 CTCACTCCTGGCTCTCGGCCAGG + Intergenic
1061207163 9:129171371-129171393 CACCCTCCCTGCTCCTGGCCAGG - Intergenic
1061667139 9:132167150-132167172 GACTTTCCTGCCTCTTGACCAGG + Intronic
1061801789 9:133116781-133116803 CCACGTCCTGGCTCCTGACCTGG - Intronic
1061837656 9:133340221-133340243 CCCAGTCCTGGCTCTGGACCTGG - Exonic
1062644958 9:137543177-137543199 CACCCTTCTTGCTCTTGCCCTGG + Intronic
1187158549 X:16743778-16743800 CATCCTCCTGGAGCATGACCAGG - Exonic
1187362768 X:18643423-18643445 CACCCTCCCCTCTCTTCACCTGG - Intronic
1189585784 X:42460447-42460469 CAACCTCCTGGCTATTCATCTGG - Intergenic
1191601713 X:63016368-63016390 CACCCCCATGTCTCTTGACTGGG - Intergenic
1192656829 X:73002348-73002370 CAAGCGCCTGGCTCTGGACCAGG + Intergenic
1192665291 X:73080653-73080675 CAAGCGCCTGGCTCTGGACCAGG - Intergenic
1197142259 X:123130330-123130352 GACCCCCATGCCTCTTGACCGGG + Intergenic
1199571305 X:149269716-149269738 TAGCCTCCTGCCTCATGACCAGG - Intergenic